G1931698



Basic Information


Item Value
gene id G1931698
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 40363023 ~ 40363385 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2209635
AGTCTCTTCAGTACTTTAGCTGTACAGATACTGAACCAATCAGTCTCTTCAGTACTTTAGCTGTACAGATACTGAACCAAGCAGTCTCTTCAGTACTTTAGCTGTACAGATACTGAACCAAACAGTCTCTTCAGCACTTTAGCTGTACAGATACTGAACCAAACAGTCTCTTCAGTACTTTAGCTGTACAGATACTGAACCAAACAGTCTCTTCAGTACTTTAGCTGTACAGATACTGAACCAAACAGTCTCTTCAGTACTTTAGCTGTACAGATACTGAACCAAACAGTCTCTTCAGTAATTTAGCTGTACAGATACTGAACCAAACAGTCTCTTCAGTACTTTAGCTGTACAGATACTGAA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2209635 True 363 lncRNA 0.39 1 40363023 40363385
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503199 LOC106613203 coding upstream 553275 39800737 ~ 39809748 (+)
trnat-agu-148 NA coding upstream 598291 39764659 ~ 39764732 (+)
LOC110503201 NA coding upstream 730644 39630663 ~ 39632379 (+)
LOC110503405 NA coding upstream 733812 39396023 ~ 39629211 (+)
LOC110516717 LOC106581405 coding upstream 1012642 39238180 ~ 39350381 (+)
LOC110503406 LOC106581179 coding downstream 80385 40443770 ~ 40535727 (+)
LOC110503211 LOC106613213 coding downstream 446793 40810178 ~ 40837501 (+)
LOC110503202 LOC106613212 coding downstream 599057 40962442 ~ 40972379 (+)
si LOC106613210 coding downstream 649293 41012678 ~ 41125378 (+)
LOC118944044 NA coding downstream 903382 41266767 ~ 41267279 (+)
G1931691 NA non-coding upstream 944 40359463 ~ 40362079 (+)
G1931638 NA non-coding upstream 82779 40280037 ~ 40280244 (+)
G1931550 NA non-coding upstream 169163 40193641 ~ 40193860 (+)
G1931548 NA non-coding upstream 169594 40193006 ~ 40193429 (+)
G1931546 NA non-coding upstream 170095 40191887 ~ 40192928 (+)
G1931754 LOC105030512 non-coding downstream 72245 40435630 ~ 40435853 (+)
G1931778 NA non-coding downstream 98525 40461910 ~ 40462122 (+)
G1931789 NA non-coding downstream 106497 40469882 ~ 40470094 (+)
G1931790 NA non-coding downstream 107041 40470426 ~ 40470679 (+)
G1931795 NA non-coding downstream 108962 40472347 ~ 40472687 (+)
G1929916 NA other upstream 257491 40089400 ~ 40105532 (+)
G1929909 NA other upstream 284691 40076476 ~ 40078332 (+)
G1929901 NA other upstream 310673 40049364 ~ 40082173 (+)
G1929891 NA other upstream 334506 40025935 ~ 40028517 (+)
G1929816 NA other upstream 473868 39888327 ~ 39889155 (+)
G1931869 NA other downstream 197827 40561212 ~ 40561906 (+)
G1932319 NA other downstream 751252 41114637 ~ 41117412 (+)
G1932564 NA other downstream 966665 41330050 ~ 41338188 (+)
LOC110503413 LOC106613251 other downstream 1931463 42140069 ~ 42335470 (+)
G1933231 LOC106581444 other downstream 1997871 42361256 ~ 42365260 (+)

Expression


G1931698 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1931698 Expression in each Bioproject

Bar chart with 4 bars.
G1931698 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network