G1931778



Basic Information


Item Value
gene id G1931778
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 40461910 ~ 40462122 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2209750
atactcggccttgtctcaggatggtaagttggtggttgaatatatccctctagtggtgtgggggctgtgctttggcaaagtgggtggggttatatccttcctgtttggccctgtctgggggtatcatcggatggggccacagtgtctcctgacccctcctgtctcagcctccagtatttatgctgcagtagtttatgtgtcggggggctaggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2209750 True 213 lncRNA 0.54 1 40461910 40462122

Neighbor


gene id symbol gene type direction distance location
LOC110503199 LOC106613203 coding upstream 652162 39800737 ~ 39809748 (+)
trnat-agu-148 NA coding upstream 697178 39764659 ~ 39764732 (+)
LOC110503201 NA coding upstream 829531 39630663 ~ 39632379 (+)
LOC110503405 NA coding upstream 832699 39396023 ~ 39629211 (+)
LOC110516717 LOC106581405 coding upstream 1111529 39238180 ~ 39350381 (+)
LOC110503211 LOC106613213 coding downstream 348056 40810178 ~ 40837501 (+)
LOC110503202 LOC106613212 coding downstream 500320 40962442 ~ 40972379 (+)
si LOC106613210 coding downstream 550556 41012678 ~ 41125378 (+)
LOC118944044 NA coding downstream 804645 41266767 ~ 41267279 (+)
LOC110512028 neus coding downstream 1561360 42023482 ~ 42078730 (+)
G1931754 LOC105030512 non-coding upstream 26057 40435630 ~ 40435853 (+)
G1931698 NA non-coding upstream 98525 40363023 ~ 40363385 (+)
G1931691 NA non-coding upstream 99831 40359463 ~ 40362079 (+)
G1931638 NA non-coding upstream 181666 40280037 ~ 40280244 (+)
G1931550 NA non-coding upstream 268050 40193641 ~ 40193860 (+)
G1931789 NA non-coding downstream 7760 40469882 ~ 40470094 (+)
G1931790 NA non-coding downstream 8304 40470426 ~ 40470679 (+)
G1931795 NA non-coding downstream 10225 40472347 ~ 40472687 (+)
G1931797 NA non-coding downstream 10901 40473023 ~ 40473605 (+)
G1931807 NA non-coding downstream 24537 40486659 ~ 40487708 (+)
G1929916 NA other upstream 356378 40089400 ~ 40105532 (+)
G1929909 NA other upstream 383578 40076476 ~ 40078332 (+)
G1929901 NA other upstream 409560 40049364 ~ 40082173 (+)
G1929891 NA other upstream 433393 40025935 ~ 40028517 (+)
G1929816 NA other upstream 572755 39888327 ~ 39889155 (+)
G1931869 NA other downstream 99090 40561212 ~ 40561906 (+)
G1932319 NA other downstream 652515 41114637 ~ 41117412 (+)
G1932564 NA other downstream 867928 41330050 ~ 41338188 (+)
LOC110503413 LOC106613251 other downstream 1832726 42140069 ~ 42335470 (+)
G1933231 LOC106581444 other downstream 1899134 42361256 ~ 42365260 (+)

Expression


G1931778 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1931778 Expression in each Bioproject

Bar chart with 18 bars.
G1931778 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network