G1931784



Basic Information


Item Value
gene id G1931784
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 40463789 ~ 40464201 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2209756
ccaaaaccatatttataattgcagtctcttgtacatctgtaaacaagcgtcctcgtcctccatgatgtctttgcctttccactctgtacagaattcaaacacagtatgtgttcagcataggaactgtaaacaatgtacaaaatgtagtacagcatgataaccaacctcattcattcaatgcagtgcagtaaatggatggcttagagttacaaatgtttatgcaatactatgcagtcatacgtattttacagtacattactgtaatgctaaaatagtcattagatagttgcatacctgttctcatttctgaaggttcgaattatggacgccactgtaaatcgactcaagttggtctggactctcagtccagcctctctcatggtcaaaccgtggttgatcacatgatcaacaag

Function


NR:

description
PREDICTED: uncharacterized protein LOC107738097

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2209756 True 413 lncRNA 0.39 1 40463789 40464201

Neighbor


gene id symbol gene type direction distance location
LOC118944043 NA coding downstream 83309 40370130 ~ 40380480 (-)
LOC110503403 fam168a coding downstream 341884 40027973 ~ 40121905 (-)
LOC118944096 NA coding downstream 438628 40023797 ~ 40025161 (-)
LOC110503195 LOC106613241 coding downstream 462129 39984918 ~ 40001660 (-)
LOC110503196 LOC106613240 coding downstream 483259 39873196 ~ 39980530 (-)
LOC118944045 NA coding upstream 898341 41362542 ~ 41375708 (-)
zbbx zbbx coding upstream 1312755 41776956 ~ 41865547 (-)
LOC118944009 LOC106613246 coding upstream 1524522 41988723 ~ 42023238 (-)
LOC110489558 LOC106613247 coding upstream 1626382 42090565 ~ 42170024 (-)
LOC110489559 LOC106613248 coding upstream 1647468 42111669 ~ 42121837 (-)
G1931780 NA non-coding downstream 1620 40461758 ~ 40462169 (-)
G1931771 NA non-coding downstream 12333 40451065 ~ 40451456 (-)
G1931758 NA non-coding downstream 25328 40438213 ~ 40438461 (-)
G1931745 NA non-coding downstream 62371 40393404 ~ 40401418 (-)
G1931796 NA non-coding upstream 8060 40472261 ~ 40472700 (-)
G1931798 NA non-coding upstream 8822 40473023 ~ 40473313 (-)
G1931799 NA non-coding upstream 11601 40475802 ~ 40476062 (-)
G1931810 NA non-coding upstream 23706 40487907 ~ 40488173 (-)
G1931812 NA non-coding upstream 24115 40488316 ~ 40488542 (-)
G1931133 LOC106613217 other downstream 1113150 39319414 ~ 39350639 (-)
dhx34 dhx34 other downstream 1376786 39058690 ~ 39087005 (-)
G1930981 LOC106613377 other downstream 1483809 38976417 ~ 38982781 (-)
G1930910 NA other downstream 1677518 38785578 ~ 38786271 (-)
G1930873 NA other downstream 1726190 38736517 ~ 38737599 (-)
G1931785 NA other upstream 1419 40465620 ~ 40465867 (-)
G1932422 NA other upstream 692170 41156371 ~ 41156733 (-)
G1933401 NA other upstream 1608926 42073127 ~ 42075939 (-)
G1933529 NA other upstream 1935696 42399897 ~ 42400327 (-)

Expression


G1931784 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1931784 Expression in each Bioproject

Bar chart with 20 bars.
G1931784 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network