G1933529



Basic Information


Item Value
gene id G1933529
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 42399897 ~ 42400327 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2211802
ttccagaacacaaagaaacagggctacattccagaacacaaagaaacagggctacattccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctatgttccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctatgttccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctatgttccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctatgttccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctacgttccagaacacaaagaaacagggctacgttccagaacac

Function


NR:

description
PREDICTED: uncharacterized protein LOC106584695

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2211802 True 431 TUCP 0.45 1 42399897 42400327

Neighbor


gene id symbol gene type direction distance location
LOC110503214 LOC106581444 coding downstream 29302 42358000 ~ 42370595 (-)
LOC110490901 LOC106613249 coding downstream 184111 42190618 ~ 42215786 (-)
LOC110489559 LOC106613248 coding downstream 278060 42111669 ~ 42121837 (-)
LOC110489558 LOC106613247 coding downstream 289244 42090565 ~ 42170024 (-)
LOC118944009 LOC106613246 coding downstream 376659 41988723 ~ 42023238 (-)
aplp2 LOC102785027 coding upstream 132207 42532534 ~ 42673783 (-)
LOC118944083 NA coding upstream 818747 43219074 ~ 43223984 (-)
LOC110503290 LOC106613395 coding upstream 1033799 43434126 ~ 43439279 (-)
LOC118944046 NA coding upstream 1101974 43502301 ~ 43504650 (-)
LOC118944047 NA coding upstream 1249079 43649406 ~ 43650309 (-)
G1933528 NA non-coding downstream 6234 42393364 ~ 42393663 (-)
G1933527 NA non-coding downstream 7687 42392001 ~ 42392210 (-)
G1933521 NA non-coding downstream 21318 42378256 ~ 42378579 (-)
G1933519 NA non-coding downstream 23012 42376460 ~ 42376885 (-)
G1933517 NA non-coding downstream 25736 42373926 ~ 42374161 (-)
G1933531 NA non-coding upstream 652 42400979 ~ 42401186 (-)
G1933532 NA non-coding upstream 7008 42407335 ~ 42407663 (-)
G1933535 NA non-coding upstream 10711 42411038 ~ 42411301 (-)
G1933536 NA non-coding upstream 10985 42411312 ~ 42411514 (-)
G1933537 NA non-coding upstream 15102 42415429 ~ 42415649 (-)
G1933401 NA other downstream 323958 42073127 ~ 42075939 (-)
G1932422 NA other downstream 1243164 41156371 ~ 41156733 (-)
G1931785 NA other downstream 1934030 40465620 ~ 40465867 (-)
G1931133 LOC106613217 other downstream 3049258 39319414 ~ 39350639 (-)
G1934061 NA other upstream 719638 43119965 ~ 43153967 (-)
G1934102 NA other upstream 799046 43199373 ~ 43199815 (-)
G1935283 NA other upstream 1856969 44257296 ~ 44258661 (-)
G1935421 NA other upstream 2120828 44521155 ~ 44521439 (-)
G1935467 NA other upstream 2178695 44579022 ~ 44585392 (-)

Expression


G1933529 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1933529 Expression in each Bioproject

Bar chart with 17 bars.
G1933529 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network