G1933537



Basic Information


Item Value
gene id G1933537
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 42415429 ~ 42415649 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2211810
ttgtattgatgttgtattgatgttgtgttgatgttgtattgatgttgtattgatgttgtattgatgttgtgttgatgttgtattgatgttgatgttgtattgatgttgtgttgatgttgtgttgatgttgtgttgatgttgtattgatgttgtgttgatgttgtgttgatgttgttgttgtattgatgttgtgttgatgttgtattgatgttgtgttgatg

Function


NR:

description
Hemagglutinin/amebocyte aggregation factor

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2211810 True 221 lncRNA 0.32 1 42415429 42415649
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503214 LOC106581444 coding downstream 44834 42358000 ~ 42370595 (-)
LOC110490901 LOC106613249 coding downstream 199643 42190618 ~ 42215786 (-)
LOC110489559 LOC106613248 coding downstream 293592 42111669 ~ 42121837 (-)
LOC110489558 LOC106613247 coding downstream 304776 42090565 ~ 42170024 (-)
LOC118944009 LOC106613246 coding downstream 392191 41988723 ~ 42023238 (-)
aplp2 LOC102785027 coding upstream 116885 42532534 ~ 42673783 (-)
LOC118944083 NA coding upstream 803425 43219074 ~ 43223984 (-)
LOC110503290 LOC106613395 coding upstream 1018477 43434126 ~ 43439279 (-)
LOC118944046 NA coding upstream 1086652 43502301 ~ 43504650 (-)
LOC118944047 NA coding upstream 1233757 43649406 ~ 43650309 (-)
G1933536 NA non-coding downstream 3915 42411312 ~ 42411514 (-)
G1933535 NA non-coding downstream 4128 42411038 ~ 42411301 (-)
G1933532 NA non-coding downstream 7766 42407335 ~ 42407663 (-)
G1933531 NA non-coding downstream 14243 42400979 ~ 42401186 (-)
G1933528 NA non-coding downstream 21766 42393364 ~ 42393663 (-)
G1933538 NA non-coding upstream 3497 42419146 ~ 42419454 (-)
G1933539 NA non-coding upstream 4701 42420350 ~ 42420568 (-)
G1933540 NA non-coding upstream 12773 42428422 ~ 42428625 (-)
G1933541 NA non-coding upstream 13349 42428998 ~ 42429312 (-)
G1933542 NA non-coding upstream 20069 42435718 ~ 42436332 (-)
G1933529 NA other downstream 15102 42399897 ~ 42400327 (-)
G1933401 NA other downstream 339490 42073127 ~ 42075939 (-)
G1932422 NA other downstream 1258696 41156371 ~ 41156733 (-)
G1931785 NA other downstream 1949562 40465620 ~ 40465867 (-)
G1934061 NA other upstream 704316 43119965 ~ 43153967 (-)
G1934102 NA other upstream 783724 43199373 ~ 43199815 (-)
G1935283 NA other upstream 1841647 44257296 ~ 44258661 (-)
G1935421 NA other upstream 2105506 44521155 ~ 44521439 (-)
G1935467 NA other upstream 2163373 44579022 ~ 44585392 (-)

Expression


G1933537 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1933537 Expression in each Bioproject

Bar chart with 3 bars.
G1933537 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network