G1933651



Basic Information


Item Value
gene id G1933651
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 42722497 ~ 42722719 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2211964
CACCATGGCTACTCTGTTGGAGAGACTAGGGAAAGATAGGGAGGGTGTTGATCCATCTGATTGGTTTAAGAGACATCTGGATACTGTGTATCAGGATGTTGTGTCCATTTACACAGATGTTTCAAAAGATCCAAGGACAGGAAGTACTGGTTCTGCGTTTTCTAGTGCAGGAATGTGGGTAGAAGTCAGGAAACGTATAATAGATAATCTGTCTGTATCCACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2211964 True 223 lncRNA 0.43 1 42722497 42722719

Neighbor


gene id symbol gene type direction distance location
LOC110503413 LOC106613251 coding upstream 387027 42140069 ~ 42335470 (+)
LOC110512028 neus coding upstream 643767 42023482 ~ 42078730 (+)
LOC118944044 NA coding upstream 1455218 41266767 ~ 41267279 (+)
si LOC106613210 coding upstream 1597119 41012678 ~ 41125378 (+)
LOC110503202 LOC106613212 coding upstream 1750118 40962442 ~ 40972379 (+)
prdm10 prdm10 coding downstream 812 42723531 ~ 42785160 (+)
cdon LOC106613390 coding downstream 343568 43066287 ~ 43212712 (+)
bcl9l LOC106613392 coding downstream 576809 43299528 ~ 43420475 (+)
ddx6 ddx6 coding downstream 717294 43440013 ~ 43465245 (+)
treh treh coding downstream 750005 43472724 ~ 43491902 (+)
G1933650 NA non-coding upstream 2364 42719927 ~ 42720133 (+)
G1933645 NA non-coding upstream 3354 42718915 ~ 42719143 (+)
G1933637 NA non-coding upstream 30951 42691346 ~ 42691546 (+)
G1933632 NA non-coding upstream 39475 42682174 ~ 42683022 (+)
G1933631 NA non-coding upstream 44833 42676779 ~ 42677664 (+)
G1933654 NA non-coding downstream 18583 42741302 ~ 42741594 (+)
G1933655 NA non-coding downstream 19698 42742417 ~ 42743207 (+)
G1933662 NA non-coding downstream 31842 42754561 ~ 42754974 (+)
G1933670 NA non-coding downstream 55378 42778097 ~ 42778911 (+)
G1933673 NA non-coding downstream 58052 42780771 ~ 42781068 (+)
G1933574 NA other upstream 187514 42531718 ~ 42534983 (+)
G1933563 st14 other upstream 221507 42495580 ~ 42500990 (+)
G1933255 NA other upstream 332236 42389427 ~ 42390261 (+)
G1933231 LOC106581444 other upstream 357237 42361256 ~ 42365260 (+)
G1933999 NA other downstream 435384 43158103 ~ 43158566 (+)
G1934201 NA other downstream 710729 43433448 ~ 43435352 (+)
G1935694 NA other downstream 2377583 45100302 ~ 45103958 (+)
G1935696 NA other downstream 2381413 45104132 ~ 45104500 (+)
G1935897 NA other downstream 2565791 45288510 ~ 45289135 (+)

Expression


G1933651 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1933651 Expression in each Bioproject

Bar chart with 10 bars.
G1933651 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network