G1935052


Basic Information

Item Value
gene id G1935052
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 44586431 ~ 44586726 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2213717
TATCCCCTCAATTTAAGGTAATATCCCCTCAGTTTAAGGTAAGATCCCCTCAGTTTAAGGTATTATCCCCCCAGTTTAGGGTAAGATCCCCTCAGTTTAAGGTAAGATCCCCTCAGTTTAAGGTAAGATCCCCTCAGTTTAAGGTAAGATCCCATCAGTTTAAGGTAAGATCCCCTCAGTTCAGTTTAAGGTAATATCCACTCAGTTTAAGGTAAGATCCCCTCAGTTTAAGG

Function

NR:

description
juxtaposed with another zinc finger protein 1-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2213717 True 233 lncRNA 0.41 2 44586431 44586726

Neighbor

gene id symbol gene type direction distance location
treh treh coding upstream 1094529 43472724 ~ 43491902 (+)
ddx6 ddx6 coding upstream 1121186 43440013 ~ 43465245 (+)
bcl9l LOC106613392 coding upstream 1165956 43299528 ~ 43420475 (+)
cdon LOC106613390 coding upstream 1373719 43066287 ~ 43212712 (+)
prdm10 prdm10 coding upstream 1801271 42723531 ~ 42785160 (+)
G1935051 NA non-coding upstream 353 44577478 ~ 44586078 (+)
G1935031 NA non-coding upstream 41686 44544492 ~ 44544745 (+)
G1935022 NA non-coding upstream 60236 44525689 ~ 44526195 (+)
G1935019 NA non-coding upstream 76291 44509764 ~ 44510140 (+)
G1935018 NA non-coding upstream 77247 44508800 ~ 44509184 (+)
G1935034 NA non-coding downstream 6731 44593457 ~ 44597077 (+)
G1935033 nectin1 non-coding downstream 11393 44598119 ~ 44603291 (+)
G1935062 NA non-coding downstream 34232 44620958 ~ 44621391 (+)
G1935072 NA non-coding downstream 49870 44636596 ~ 44637635 (+)
G1935074 NA non-coding downstream 53172 44639898 ~ 44640849 (+)
G1934201 NA other upstream 1151079 43433448 ~ 43435352 (+)
G1933999 NA other upstream 1427865 43158103 ~ 43158566 (+)
G1933574 NA other upstream 2051448 42531718 ~ 42534983 (+)
G1933563 st14 other upstream 2085441 42495580 ~ 42500990 (+)
G1933255 NA other upstream 2196170 42389427 ~ 42390261 (+)
G1935694 NA other downstream 513576 45100302 ~ 45103958 (+)
G1935696 NA other downstream 517406 45104132 ~ 45104500 (+)
G1935897 NA other downstream 701784 45288510 ~ 45289135 (+)
G1936028 NA other downstream 898617 45485343 ~ 45492999 (+)
G1936029 NA other downstream 899010 45485736 ~ 45487871 (+)

Expression


Co-expression Network