G1940966



Basic Information


Item Value
gene id G1940966
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 3739538 ~ 3739790 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2220368
ctctatgcatactggcagctccttgctgactggcagctctatacagactggcagctccatgcagactggcagctccatgcagactggcagctccgaacaggcgggagactccggcaacgctgtagaggcggaaagctctgacagcgctaaacaggcgggagactccaacagcgctgaagaggaggaaggctctggcagcgctgaacaggtgagagac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2220368 True 217 TUCP 0.59 2 3739538 3739790
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936289 LOC106610601 coding upstream 106916 3607505 ~ 3632622 (+)
LOC110505239 NA coding upstream 165224 3384893 ~ 3574638 (+)
LOC118944335 NA coding upstream 467907 3262161 ~ 3271631 (+)
supt7l supt7l coding upstream 838939 2887551 ~ 2900599 (+)
si:dkey-16j16.4 LOC106610604 coding upstream 867815 2807447 ~ 2871723 (+)
LOC110505243 LOC106610599 coding downstream 58025 3797815 ~ 3893089 (+)
eprs1 LOC106610596 coding downstream 992388 4732178 ~ 4820880 (+)
LOC118944384 NA coding downstream 1077998 4817788 ~ 4817925 (+)
LOC118944385 NA coding downstream 1079278 4819068 ~ 4819204 (+)
LOC118944339 NA coding downstream 1140091 4879881 ~ 4883140 (+)
G1940842 NA non-coding upstream 203320 3535402 ~ 3536218 (+)
G1940770 NA non-coding upstream 302526 3426381 ~ 3437012 (+)
G1940701 NA non-coding upstream 414501 3324694 ~ 3325037 (+)
G1940699 NA non-coding upstream 415744 3323533 ~ 3323794 (+)
G1941033 NA non-coding downstream 156390 3896180 ~ 3922776 (+)
G1941145 NA non-coding downstream 303989 4043779 ~ 4043980 (+)
G1941154 NA non-coding downstream 317847 4057637 ~ 4167716 (+)
G1941155 NA non-coding downstream 318476 4058266 ~ 4101564 (+)
G1941162 NA non-coding downstream 323777 4063567 ~ 4070806 (+)
G1938701 NA other upstream 1933501 1805513 ~ 1806037 (+)
ccdc32 LOC106610623 other upstream 2770475 963874 ~ 969082 (+)
G1937035 NA other upstream 3083621 655528 ~ 655917 (+)
LOC110505250 LOC106610594 other downstream 1646235 5385664 ~ 5404183 (+)
G1943555 NA other downstream 1959228 5699018 ~ 5699584 (+)
LOC110505260 LOC106613993 other downstream 2072743 5812504 ~ 5824543 (+)
G1944456 LOC106598199 other downstream 2725999 6465789 ~ 6467123 (+)
G1945166 NA other downstream 3204421 6944211 ~ 6951262 (+)

Expression


G1940966 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1940966 Expression in each Bioproject

Bar chart with 18 bars.
G1940966 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network