G1950292



Basic Information


Item Value
gene id G1950292
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 10884863 ~ 10885108 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2230350
agaagcaatcaatcaatcagattccaaactctccaccatggccaagaccaaagagctctccaaggatgtcagggacaagattgtagacctacacaaggctggaatgggctacaagaccatcgccaagcagcttggtgagaaggtgacaacagttggtgcgattattcacaaatggaagaaacacaaaagaactgtcaatctccctcagcctggggctccatccaagatctcacctcgtggagttgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2230350 True 246 TUCP 0.48 1 10884863 10885108

Neighbor


gene id symbol gene type direction distance location
LOC110505331 LOC106610712 coding downstream 45720 10826445 ~ 10839143 (-)
LOC110505329 LOC106610716 coding downstream 85509 10769777 ~ 10799354 (-)
LOC110504315 NA coding downstream 219508 10654686 ~ 10665355 (-)
LOC110505327 LOC106610719 coding downstream 277825 10579874 ~ 10607038 (-)
LOC100136195 LOC100136195 coding downstream 486813 10386771 ~ 10398050 (-)
smyd3 smyd3 coding upstream 136617 11021725 ~ 11214958 (-)
LOC110505336 LOC106610732 coding upstream 332686 11215364 ~ 11242325 (-)
LOC110516394 LOC106588272 coding upstream 424720 11309828 ~ 11314640 (-)
LOC118936486 LOC106588272 coding upstream 428933 11314041 ~ 11325207 (-)
LOC110505343 LOC106561535 coding upstream 432085 11317132 ~ 11331281 (-)
G1950291 NA non-coding downstream 614 10884044 ~ 10884249 (-)
G1950289 NA non-coding downstream 2967 10881299 ~ 10881896 (-)
G1950285 NA non-coding downstream 14085 10870574 ~ 10870778 (-)
G1950284 NA non-coding downstream 14994 10869508 ~ 10869869 (-)
G1950282 NA non-coding downstream 18578 10866053 ~ 10866285 (-)
G1950294 NA non-coding upstream 3172 10888280 ~ 10888482 (-)
G1950296 LOC106610711 non-coding upstream 9486 10894594 ~ 10895284 (-)
G1950331 NA non-coding upstream 80517 10965625 ~ 10966100 (-)
G1950332 NA non-coding upstream 83241 10968349 ~ 10968551 (-)
G1950333 LOC106610711 non-coding upstream 84520 10969628 ~ 10970137 (-)
G1950222 LOC106610714 other downstream 132854 10751119 ~ 10752009 (-)
G1949387 NA other downstream 935503 9948906 ~ 9949360 (-)
G1945534 NA other downstream 3962499 6921985 ~ 6922364 (-)
G1945526 LOC100136012 other downstream 3969636 6914595 ~ 6915227 (-)
LOC118944219 vps4a other upstream 511960 11397068 ~ 11481374 (-)
LOC110505340 LOC106588272 other upstream 522230 11394818 ~ 11410200 (-)
LOC110505352 LOC106588272 other upstream 573091 11456367 ~ 11473970 (-)
LOC110505361 LOC106610752 other upstream 1859298 12744406 ~ 12755099 (-)
LOC110505391 LOC106574021 other upstream 3198363 14083317 ~ 14105695 (-)

Expression


G1950292 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1950292 Expression in each Bioproject

Bar chart with 20 bars.
G1950292 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network