G1951340



Basic Information


Item Value
gene id G1951340
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 12265191 ~ 12265456 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2231543
tcatggtgttgtagtgttatggtcatggtgttgtagtgttatggtcatggtgttgtagtgttatggtcatggtgttgtagtgttatggtcatggtgtggtagtgttatggtcatggtgttgtagtgttatggtcatggtgttgtagtgttatggtcatggtgttgtagtgttatggtcatgatgtggtagtgttgtggtcatggtgttgtagtgttatggtcatggtgttgtagtgttatggtcatggtgttgtagtgttatggtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2231543 True 266 lncRNA 0.42 1 12265191 12265456

Neighbor


gene id symbol gene type direction distance location
esrrga LOC106570958 coding upstream 25033 12134910 ~ 12240158 (+)
LOC110505357 NA coding upstream 305653 11956246 ~ 11959538 (+)
kif28 kif28p coding upstream 713356 11536098 ~ 11551835 (+)
LOC110505350 LOC106610733 coding upstream 732491 11503450 ~ 11532700 (+)
LOC110505337 scpdh coding upstream 969811 11267373 ~ 11295380 (+)
LOC110505364 LOC106610747 coding downstream 374226 12639682 ~ 12647343 (+)
LOC110505366 LOC106610818 coding downstream 385469 12650925 ~ 12662628 (+)
LOC110504192 LOC106610748 coding downstream 399567 12665023 ~ 12701326 (+)
LOC110505362 LOC106610749 coding downstream 436606 12702062 ~ 12718303 (+)
rpap1 rpap1 coding downstream 490793 12756249 ~ 12768426 (+)
G1951174 NA non-coding upstream 75942 12188656 ~ 12189249 (+)
G1951102 NA non-coding upstream 214163 12050694 ~ 12051028 (+)
G1951099 NA non-coding upstream 217994 12046974 ~ 12047197 (+)
G1951040 NA non-coding upstream 336291 11928646 ~ 11928900 (+)
G1951033 NA non-coding upstream 341992 11922905 ~ 11923199 (+)
G1951343 NA non-coding downstream 2275 12267731 ~ 12268490 (+)
G1951345 NA non-coding downstream 5016 12270472 ~ 12270792 (+)
G1951347 NA non-coding downstream 7435 12272891 ~ 12273274 (+)
G1951349 NA non-coding downstream 12687 12278143 ~ 12282152 (+)
G1951354 NA non-coding downstream 22756 12288212 ~ 12288824 (+)
G1950642 LOC106610734 other upstream 707283 11554525 ~ 11557908 (+)
LOC110505330 LOC106610717 other upstream 1450627 10809234 ~ 10814564 (+)
G1949039 1433b other upstream 1876478 10386771 ~ 10462100 (+)
G1949170 NA other upstream 1892502 10371653 ~ 10372689 (+)
G1949041 LOC106610723 other upstream 1904035 10357613 ~ 10361156 (+)
LOC118944376 NA other downstream 822280 13087702 ~ 13089271 (+)
LOC110505390 LOC106610772 other downstream 1583142 13848535 ~ 13860898 (+)
G1953696 NA other downstream 2088369 14353825 ~ 14354124 (+)
tfb1m LOC106610789 other downstream 2716321 14947569 ~ 14994632 (+)
G1954503 NA other downstream 2772690 15038146 ~ 15039536 (+)

Expression


G1951340 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1951340 Expression in each Bioproject

Bar chart with 7 bars.
G1951340 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network