G1955495


Basic Information

Item Value
gene id G1955495
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 15825462 ~ 15826138 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2236105
atatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtttccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgtgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagccttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagtgtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttgatgattgtgtcccacttgttgttgattcttcacaaaaaaaatacagttttatatctttatgtttgaagcctgaaatgtggcaaaaggtcgcaaagtt

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2236105 True 677 lncRNA 0.41 1 15825462 15826138

Neighbor

gene id symbol gene type direction distance location
kiz kiz coding downstream 92831 15692793 ~ 15732631 (-)
pax1a pax1 coding downstream 290088 15530422 ~ 15535374 (-)
LOC110505411 LOC106610795 coding downstream 583246 15233872 ~ 15242216 (-)
LOC110505405 LOC106610791 coding downstream 597783 15171629 ~ 15227679 (-)
LOC110505406 LOC106610793 coding downstream 661286 15155674 ~ 15164176 (-)
insm1b insm1 coding upstream 193205 16019343 ~ 16021953 (-)
LOC110505423 LOC106610820 coding upstream 230083 16056221 ~ 16058622 (-)
LOC110505426 LOC106610808 coding upstream 261868 16088006 ~ 16091581 (-)
LOC110505428 LOC106610809 coding upstream 281085 16107223 ~ 16112506 (-)
LOC100301695 ppie coding upstream 288780 16114918 ~ 16119474 (-)
G1955490 NA non-coding downstream 2935 15822291 ~ 15822527 (-)
G1955480 NA non-coding downstream 16599 15808577 ~ 15808863 (-)
G1955441 NA non-coding downstream 66949 15758204 ~ 15758513 (-)
G1955042 NA non-coding downstream 361898 15463155 ~ 15463564 (-)
G1955014 NA non-coding downstream 381859 15443374 ~ 15443603 (-)
G1955522 NA non-coding upstream 20288 15846426 ~ 15846643 (-)
G1955835 NA non-coding upstream 59457 15885595 ~ 15886344 (-)
G1955836 NA non-coding upstream 60351 15886489 ~ 15886694 (-)
G1955837 NA non-coding upstream 60598 15886736 ~ 15886959 (-)
G1955846 NA non-coding upstream 75908 15902046 ~ 15902256 (-)
G1954972 NA other downstream 437812 15365302 ~ 15387650 (-)
G1954080 LOC106610776 other downstream 1429771 14395307 ~ 14395691 (-)
LOC110505391 LOC106574021 other downstream 1740354 14083317 ~ 14105695 (-)
LOC110505361 LOC106610752 other downstream 3073224 12744406 ~ 12755099 (-)
LOC110505352 LOC106588272 other downstream 4365146 11456367 ~ 11473970 (-)
G1955863 NA other upstream 111721 15937859 ~ 15940045 (-)
G1955882 ralgapa2 other upstream 129062 15955200 ~ 15955685 (-)
G1955897 NA other upstream 145671 15971809 ~ 15972164 (-)
G1956007 NA other upstream 349476 16175614 ~ 16177093 (-)

Expression

G1955495 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1955495 Expression in each Bioproject

Bar chart with 21 bars.
G1955495 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network