G1960753



Basic Information


Item Value
gene id G1960753
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 20417312 ~ 20417521 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2241932
GTTATCCTCTGGTAGACCTGATATTGAAGGAAGAAAACTTAAATTCTCCACCATTAATTGCATTATTCCTTATTTTAAAGCAATGAGAAGAGGCTGTGAGTGGATCCTAGTATGTTGAATGTGATGCTGTACCTCTCCAGGAAGGTTTGAGGCCAGAGACTACAGGGTTGATTATTGTTCCCACAGGCCAGGACTTTGCCAGAAGGTTCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2241932 True 210 lncRNA 0.42 1 20417312 20417521
Loading

Neighbor


gene id symbol gene type direction distance location
zc2hc1c zc2hc1c coding upstream 6451 20407861 ~ 20410861 (+)
tmeda tmeda coding upstream 16964 20387433 ~ 20400348 (+)
LOC110505545 tgfb3 coding upstream 193034 20210196 ~ 20224278 (+)
LOC110505540 prox2 coding upstream 473870 19926648 ~ 19943442 (+)
LOC110505538 LOC106611054 coding upstream 499705 19908000 ~ 19917607 (+)
LOC110505558 LOC106611039 coding downstream 8323 20425844 ~ 20427892 (+)
LOC110505557 LOC106611038 coding downstream 10469 20427990 ~ 20430387 (+)
LOC118944247 LOC106611040 coding downstream 15100 20432621 ~ 20434988 (+)
LOC110505559 LOC106611036 coding downstream 23698 20441219 ~ 20500439 (+)
LOC110505561 LOC106611034 coding downstream 105544 20523065 ~ 20542189 (+)
G1960700 NA non-coding upstream 82468 20334558 ~ 20334844 (+)
G1960699 NA non-coding upstream 82929 20334179 ~ 20334383 (+)
G1960693 NA non-coding upstream 92959 20323643 ~ 20324353 (+)
G1960689 NA non-coding upstream 97444 20319640 ~ 20319868 (+)
G1960438 NA non-coding upstream 180706 20185571 ~ 20236606 (+)
G1960755 NA non-coding downstream 789 20418310 ~ 20418678 (+)
G1960761 NA non-coding downstream 6923 20424444 ~ 20424677 (+)
G1960762 NA non-coding downstream 7415 20424936 ~ 20425240 (+)
G1960776 NA non-coding downstream 26723 20444244 ~ 20447906 (+)
G1960805 NA non-coding downstream 124753 20542274 ~ 20544850 (+)
LOC110505516 LOC106611074 other upstream 1267112 19132397 ~ 19150399 (+)
G1959241 LOC106613263 other upstream 1268956 19147948 ~ 19148356 (+)
G1957752 LOC106610850 other upstream 2463824 17948648 ~ 17953488 (+)
LOC110505477 LOC106610865 other upstream 2789281 17611871 ~ 17628031 (+)
LOC110504198 mthfd1 other upstream 3051718 17349032 ~ 17366266 (+)
G1960756 NA other downstream 1473 20418994 ~ 20419306 (+)
G1960851 NA other downstream 216618 20634139 ~ 20635612 (+)
G1960977 NA other downstream 404796 20822317 ~ 20822638 (+)
G1961468 NA other downstream 621684 21039205 ~ 21039800 (+)
G1961492 NA other downstream 650443 21067964 ~ 21068669 (+)

Expression


G1960753 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G1960753 Expression in each Bioproject

Bar chart with 1 bar.
G1960753 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network