G1960761



Basic Information


Item Value
gene id G1960761
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 20424444 ~ 20424677 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2241940
ggtgcggtctgcacaacgcatcaccggggacaaactacctgccctccatgacacctacagcacccgatgtcacagaaaggccaaaaagatcatcaaggacatcaaccacctgagccactggctgttcacaccactaccatccagaaggcgaggtcagtacaggtgcatcaaagctgggaccgagagactgaaaaacagcttctatctcaaggccatcagactgctaaatagcaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2241940 True 234 lncRNA 0.52 1 20424444 20424677

Neighbor


gene id symbol gene type direction distance location
zc2hc1c zc2hc1c coding upstream 13583 20407861 ~ 20410861 (+)
tmeda tmeda coding upstream 24096 20387433 ~ 20400348 (+)
LOC110505545 tgfb3 coding upstream 200166 20210196 ~ 20224278 (+)
LOC110505540 prox2 coding upstream 481002 19926648 ~ 19943442 (+)
LOC110505538 LOC106611054 coding upstream 506837 19908000 ~ 19917607 (+)
LOC110505558 LOC106611039 coding downstream 1167 20425844 ~ 20427892 (+)
LOC110505557 LOC106611038 coding downstream 3313 20427990 ~ 20430387 (+)
LOC118944247 LOC106611040 coding downstream 7944 20432621 ~ 20434988 (+)
LOC110505559 LOC106611036 coding downstream 16542 20441219 ~ 20500439 (+)
LOC110505561 LOC106611034 coding downstream 98388 20523065 ~ 20542189 (+)
G1960755 NA non-coding upstream 5766 20418310 ~ 20418678 (+)
G1960753 NA non-coding upstream 6923 20417312 ~ 20417521 (+)
G1960700 NA non-coding upstream 89600 20334558 ~ 20334844 (+)
G1960699 NA non-coding upstream 90061 20334179 ~ 20334383 (+)
G1960693 NA non-coding upstream 100091 20323643 ~ 20324353 (+)
G1960762 NA non-coding downstream 259 20424936 ~ 20425240 (+)
G1960776 NA non-coding downstream 19567 20444244 ~ 20447906 (+)
G1960805 NA non-coding downstream 117597 20542274 ~ 20544850 (+)
G1960842 NA non-coding downstream 181211 20605888 ~ 20606151 (+)
G1960846 NA non-coding downstream 197791 20622468 ~ 20622886 (+)
G1960756 NA other upstream 5138 20418994 ~ 20419306 (+)
LOC110505516 LOC106611074 other upstream 1274244 19132397 ~ 19150399 (+)
G1959241 LOC106613263 other upstream 1276088 19147948 ~ 19148356 (+)
G1957752 LOC106610850 other upstream 2470956 17948648 ~ 17953488 (+)
LOC110505477 LOC106610865 other upstream 2796413 17611871 ~ 17628031 (+)
G1960851 NA other downstream 209462 20634139 ~ 20635612 (+)
G1960977 NA other downstream 397640 20822317 ~ 20822638 (+)
G1961468 NA other downstream 614528 21039205 ~ 21039800 (+)
G1961492 NA other downstream 643287 21067964 ~ 21068669 (+)
G1962316 NA other downstream 1367506 21792183 ~ 21844010 (+)

Expression


G1960761 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1960761 Expression in each Bioproject

Bar chart with 19 bars.
G1960761 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network