G1961468


Basic Information

Item Value
gene id G1961468
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 21039205 ~ 21039800 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2242844
tcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagtcatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaacttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgcacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaacattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacacatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcaaatgctctccatccaacctcactgagctcgagctgttttgcaag

Function

NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2242844 True 596 TUCP 0.43 1 21039205 21039800
Loading

Neighbor

gene id symbol gene type direction distance location
otx2b LOC107085600 coding upstream 63106 20970016 ~ 20976099 (+)
exoc5 exoc5 coding upstream 166727 20855638 ~ 20872478 (+)
LOC118944365 LOC106611023 coding upstream 193425 20839956 ~ 20845780 (+)
slc35f4 slc35f4 coding upstream 199544 20814027 ~ 20839661 (+)
zdhhc22 zdhhc22 coding upstream 335348 20700975 ~ 20703857 (+)
LOC118944389 NA coding downstream 27842 21067642 ~ 21067775 (+)
LOC110504348 lpp60 coding downstream 148495 21188295 ~ 21208795 (+)
LOC118944379 NA coding downstream 174478 21214278 ~ 21214330 (+)
LOC110505584 NA coding downstream 182566 21222366 ~ 21223516 (+)
LOC110505582 LOC106610923 coding downstream 187650 21227450 ~ 21323763 (+)
G1961462 NA non-coding upstream 9666 21029272 ~ 21029539 (+)
G1961449 NA non-coding upstream 22392 21016596 ~ 21016813 (+)
G1961434 NA non-coding upstream 52705 20986247 ~ 20986500 (+)
G1961433 NA non-coding upstream 53260 20985527 ~ 20985945 (+)
G1961432 NA non-coding upstream 53746 20984776 ~ 20985459 (+)
G1961470 NA non-coding downstream 3622 21043422 ~ 21043759 (+)
G1961482 NA non-coding downstream 18470 21058270 ~ 21058517 (+)
G1961491 NA non-coding downstream 31497 21071297 ~ 21073200 (+)
G1961493 peli2 non-coding downstream 33895 21073695 ~ 21074857 (+)
G1961458 ktn1 non-coding downstream 65343 21105143 ~ 21105952 (+)
G1960977 NA other upstream 216567 20822317 ~ 20822638 (+)
G1960851 NA other upstream 403593 20634139 ~ 20635612 (+)
G1960756 NA other upstream 619899 20418994 ~ 20419306 (+)
LOC110505516 LOC106611074 other upstream 1889005 19132397 ~ 19150399 (+)
G1959241 LOC106613263 other upstream 1890849 19147948 ~ 19148356 (+)
G1961492 NA other downstream 28164 21067964 ~ 21068669 (+)
G1962316 NA other downstream 752383 21792183 ~ 21844010 (+)
LOC110505603 LOC106610998 other downstream 798706 21838453 ~ 21886964 (+)
G1962880 rtn1 other downstream 1229155 22250058 ~ 22274663 (+)
lrrc9 LOC106610979 other downstream 1270544 22297012 ~ 22318009 (+)

Expression

G1961468 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1961468 Expression in each Bioproject

Bar chart with 21 bars.
G1961468 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network