G1962316



Basic Information


Item Value
gene id G1962316
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 21792183 ~ 21844010 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2243748
ctccatccatcttcccatcaattttaaccatcttccctgtccctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgtaaaatacctgagactgggacagagatttgtcttccaacaagacaatgatccaaaacataaagtaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctccagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2243748 True 431 TUCP 0.42 2 21792183 21844010

Neighbor


gene id symbol gene type direction distance location
LOC110505601 LOC106611002 coding upstream 20301 21758745 ~ 21771882 (+)
LOC110505599 NA coding upstream 45586 21744793 ~ 21746597 (+)
LOC118944344 NA coding upstream 50574 21739519 ~ 21741609 (+)
ddx24 ddx24 coding upstream 76882 21710791 ~ 21715301 (+)
si:ch1073-416d2.3 LOC106611008 coding upstream 81277 21708375 ~ 21710906 (+)
itpk1b LOC106597151 coding downstream 63426 21907436 ~ 21967129 (+)
chmp3 LOC106610994 coding downstream 146801 21990811 ~ 21997582 (+)
LOC110505607 LOC106610991 coding downstream 155680 21999690 ~ 22016010 (+)
zfyve28 LOC106610988 coding downstream 209365 22053375 ~ 22117130 (+)
LOC110505613 LOC106610987 coding downstream 273758 22117768 ~ 22171900 (+)
G1962293 NA non-coding upstream 47429 21744479 ~ 21744754 (+)
G1962235 NA non-coding upstream 162741 21629220 ~ 21629442 (+)
G1962432 NA non-coding downstream 117049 21961059 ~ 21962481 (+)
G1962397 NA non-coding downstream 123502 21967512 ~ 21968273 (+)
G1962435 LOC106610996 non-coding downstream 128419 21972429 ~ 21973320 (+)
G1962438 NA non-coding downstream 131961 21975971 ~ 21976292 (+)
G1962396 NA non-coding downstream 144052 21988062 ~ 21989954 (+)
G1961492 NA other upstream 723514 21067964 ~ 21068669 (+)
G1961468 NA other upstream 752383 21039205 ~ 21039800 (+)
G1960977 NA other upstream 969545 20822317 ~ 20822638 (+)
G1960851 NA other upstream 1156571 20634139 ~ 20635612 (+)
G1960756 NA other upstream 1372877 20418994 ~ 20419306 (+)
G1962880 rtn1 other downstream 424945 22250058 ~ 22274663 (+)
lrrc9 LOC106610979 other downstream 466334 22297012 ~ 22318009 (+)
G1962949 NA other downstream 548581 22392591 ~ 22392956 (+)
G1963734 NA other downstream 1073936 22917946 ~ 22918686 (+)
G1964177 NA other downstream 1761924 23605934 ~ 23613765 (+)

Expression


G1962316 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1962316 Expression in each Bioproject

Bar chart with 19 bars.
G1962316 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network