G1963182



Basic Information


Item Value
gene id G1963182
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 22412357 ~ 22412731 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2244759
gctatatactgtacacaggttaccagtactgagtcgatgtgcaggggtgcgagataattgaggtagatatgtacgctatagagtggggagaacaagtatttgatacactgccgattttgcaggttttcctacttacaaagcatgtagaggtctggaatttttatcataggtacacttcaactgtgagagactgaatctaaaacaaaaatccagaaaatcacattgtatgatttctaagtaattaattagcattttattgcatgacataagtatttgatacatcagaaaagcagaacttaatatttggtacagaaacctttgtttgcaattacagagatcacacgtttcctgtagttcttgaccaagtttgcacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2244759 True 375 lncRNA 0.36 1 22412357 22412731
Loading

Neighbor


gene id symbol gene type direction distance location
dhrs7 dhrs7 coding downstream 39743 22365298 ~ 22372614 (-)
rtn1a rtn1 coding downstream 115675 22250512 ~ 22296682 (-)
LOC110504206 LOC106610983 coding downstream 191132 22219608 ~ 22221225 (-)
LOC110505614 LOC106610986 coding downstream 226245 22176162 ~ 22186112 (-)
cfap99 cfap99 coding downstream 359773 22042184 ~ 22052584 (-)
six1a six1 coding upstream 85440 22498171 ~ 22500337 (-)
six4a LOC106610972 coding upstream 95702 22508433 ~ 22513823 (-)
LOC118944370 NA coding upstream 157541 22570272 ~ 22572476 (-)
LOC110505631 LOC106610967 coding upstream 291717 22704448 ~ 22726005 (-)
LOC110504330 gphb5 coding upstream 479352 22892083 ~ 22893341 (-)
G1963180 NA non-coding downstream 2393 22409742 ~ 22409964 (-)
G1963178 NA non-coding downstream 3832 22408323 ~ 22408525 (-)
G1963176 NA non-coding downstream 6668 22405468 ~ 22405689 (-)
G1963162 NA non-coding downstream 66001 22345960 ~ 22346356 (-)
G1963148 NA non-coding downstream 84185 22327849 ~ 22328172 (-)
G1963194 NA non-coding upstream 16387 22429118 ~ 22429340 (-)
G1963195 NA non-coding upstream 17320 22430051 ~ 22430359 (-)
G1963228 NA non-coding upstream 64221 22476952 ~ 22477213 (-)
G1963230 NA non-coding upstream 65874 22478605 ~ 22478820 (-)
G1963411 NA non-coding upstream 94046 22506777 ~ 22507177 (-)
G1962803 LOC106610988 other downstream 315861 22095519 ~ 22096496 (-)
G1962524 LOC106610994 other downstream 414787 21990844 ~ 21997570 (-)
G1962691 NA other downstream 525422 21876057 ~ 21886935 (-)
G1961670 NA other downstream 1242698 21164411 ~ 21169659 (-)
LOC110505583 NA other downstream 1442902 20962833 ~ 20969500 (-)
G1963846 NA other upstream 624160 23036891 ~ 23045704 (-)
G1964564 NA other upstream 752301 23165032 ~ 23168113 (-)
G1964592 LOC106569888 other upstream 809242 23221973 ~ 23222503 (-)
G1964728 NA other upstream 1012832 23425563 ~ 23428841 (-)
G1967882 NA other upstream 4122633 26535364 ~ 26538708 (-)

Expression


G1963182 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1963182 Expression in each Bioproject

Bar chart with 20 bars.
G1963182 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network