G1969397



Basic Information


Item Value
gene id G1969397
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 28143198 ~ 28143576 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2251545
ctgtcctagacttggcactccggtaccgcttgccatgcggtagcagagagaacagtctatgactggggtggctggggtctttgacaatttttagggtcttcctctgacaccacctggtgtagaggtcctggatggcaggcagcttagccccagtgatgtactgggctgtacgcactaccctctgtagtgccttgcggtcagaggccgagcaattgctgtaccaggcagtgatgcaacaagtcaggatgctctcgatgttgcagctgtagaaccttttgaggatctcaggacccatgccaaatctttttagtttcctgagggggaataggctttgtcgtgtcctcttcacgactgtcttggtgtgtttggaccattctag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2251545 True 379 lncRNA 0.53 1 28143198 28143576
Loading

Neighbor


gene id symbol gene type direction distance location
pnn LOC100380709 coding upstream 36822 28099654 ~ 28106376 (+)
gemin2 LOC106611181 coding upstream 43939 28094505 ~ 28099259 (+)
LOC110505741 LOC106611180 coding upstream 77532 28058192 ~ 28065667 (+)
ppp2r3c LOC106611177 coding upstream 92072 28041601 ~ 28051126 (+)
nfkbiab LOC106611175 coding upstream 133717 28006450 ~ 28009481 (+)
LOC110505743 LOC106611182 coding downstream 404972 28548548 ~ 28601863 (+)
LOC110504335 LOC106611218 coding downstream 957486 29101062 ~ 29106042 (+)
ccdc175 LOC106611218 coding downstream 962631 29106207 ~ 29114965 (+)
LOC110505748 gpr135 coding downstream 985467 29129043 ~ 29136833 (+)
gjb9a LOC106611221 coding downstream 1128426 29272002 ~ 29274608 (+)
G1969387 NA non-coding upstream 12496 28130482 ~ 28130702 (+)
G1969384 NA non-coding upstream 26424 28116571 ~ 28116774 (+)
G1969263 NA non-coding upstream 76549 28065726 ~ 28066649 (+)
G1969369 NA non-coding upstream 105953 28037028 ~ 28037245 (+)
G1969408 NA non-coding downstream 17733 28161309 ~ 28161695 (+)
G1969418 NA non-coding downstream 32281 28175857 ~ 28176402 (+)
G1969420 NA non-coding downstream 34025 28177601 ~ 28177905 (+)
G1969428 NA non-coding downstream 46969 28190545 ~ 28190864 (+)
G1969814 NA non-coding downstream 139115 28282691 ~ 28283744 (+)
LOC110505721 ccdc88c other upstream 1054882 26988390 ~ 27099710 (+)
G1967965 NA other upstream 1487862 26654905 ~ 26655336 (+)
G1967032 NA other upstream 2309877 25831576 ~ 25833321 (+)
LOC110505697 ypel5 other upstream 3351604 24788926 ~ 24791594 (+)
G1965396 NA other upstream 3576051 24565731 ~ 24567147 (+)
G1970001 NA other downstream 270024 28413600 ~ 28413919 (+)
G1971104 NA other downstream 1330544 29474120 ~ 29478383 (+)
LOC110505775 LOC106611224 other downstream 2179937 30092455 ~ 30330735 (+)
G1972242 NA other downstream 2486752 30630328 ~ 30632667 (+)
G1972244 NA other downstream 2493478 30637054 ~ 30655039 (+)

Expression


G1969397 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1969397 Expression in each Bioproject

Bar chart with 20 bars.
G1969397 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network