G1976897 (LOC106585398)



Basic Information


Item Value
gene id G1976897
gene name LOC106585398
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 34227858 ~ 34228499 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2259878
CAATCCTCTGTCCTCCGGCGTAGTGCAGGGACTCGAGCAGGCAGGGACTCGAGCAGGCAGGGACTCGAGCAGGCAGGGACTCGAGCAGGCAGGGACTCGAACAGGCAGGGACTCGAACCTTGGATCCAGTGCAATAGATCTATGAACGTAGTCCTGTACATTAGGGGGGTATCTGGGGTTCAGGTCCTCTCTAATGGCAGCCTTGACATCTCTAGTGATGGTGCTGTCTTCCTCACTTGGGGCCATGGATTGCAGAATCCTTGTTTTCAGAGGTAGGATCATGGACACAGACAGTGCAGTTTCAGTGCTCAGTAGGTTTGTAACTGTTTTGTGGGGTTTGATCACCTGGAGGACCTCCTCTGCTACTTTCACATCATCATCAGACAAGGTGACGATGTCTTTATGTTTTTTCAGGGTCTTGTCTGTCAGTGCAGAGTATACAGCTGTCTGCTGCTCAAGATAGAGCTCCAACATGTCAAAGTGAATTTCCATGTTGTGACATGGTGTATGAGCT

Function


NR:

description
PREDICTED: zinc finger BED domain-containing protein 4-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2259878 True 514 lncRNA 0.51 2 34227858 34228499

Neighbor


gene id symbol gene type direction distance location
LOC118944181 NA coding downstream 59600 34167460 ~ 34168258 (-)
mpp5a LOC106611266 coding downstream 110011 34073214 ~ 34117847 (-)
eif2s1a if2a coding downstream 155249 34069156 ~ 34072609 (-)
LOC110504228 NA coding downstream 168283 34053551 ~ 34059575 (-)
LOC110505815 LOC106611267 coding downstream 210886 33989997 ~ 34016972 (-)
LOC110504230 LOC106611223 coding upstream 63969 34292468 ~ 34442343 (-)
pth2 NA coding upstream 470670 34699169 ~ 34700207 (-)
rin3 LOC106611275 coding upstream 487229 34715728 ~ 34739802 (-)
LOC110505825 LOC106611276 coding upstream 546385 34774884 ~ 34893972 (-)
LOC110504231 LOC106611278 coding upstream 669077 34897576 ~ 34912793 (-)
G1976896 NA non-coding downstream 223 34226704 ~ 34227635 (-)
G1976872 NA non-coding downstream 45988 34181243 ~ 34181870 (-)
G1976866 NA non-coding downstream 60784 34166621 ~ 34167074 (-)
G1976857 NA non-coding downstream 82253 34144447 ~ 34145605 (-)
G1976821 NA non-coding downstream 159398 34068280 ~ 34068460 (-)
G1976901 NA non-coding upstream 11503 34240002 ~ 34246788 (-)
G1976915 NA non-coding upstream 37551 34266050 ~ 34266253 (-)
G1976932 NA non-coding upstream 59890 34288389 ~ 34288718 (-)
G1977027 NA non-coding upstream 217280 34445779 ~ 34446335 (-)
G1975763 NA other downstream 671047 33556430 ~ 33556811 (-)
G1975453 NA other downstream 903533 33319729 ~ 33324325 (-)
G1974000 NA other downstream 2240974 31986443 ~ 31986884 (-)
G1973835 LOC106611243 other downstream 2609359 31614421 ~ 31618499 (-)
G1973793 NA other downstream 2642812 31584540 ~ 31585046 (-)
G1977046 NA other upstream 249121 34477620 ~ 34478809 (-)
G1977226 NA other upstream 646886 34875385 ~ 34876181 (-)
LOC110505829 LOC106611279 other upstream 741653 34970065 ~ 35000444 (-)
G1977346 NA other upstream 798601 35027100 ~ 35100978 (-)
G1977392 NA other upstream 824551 35053050 ~ 35056926 (-)

Expression


G1976897(LOC106585398) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1976897(LOC106585398) Expression in each Bioproject

Bar chart with 21 bars.
G1976897(LOC106585398) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network