G1977049



Basic Information


Item Value
gene id G1977049
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 34480039 ~ 34480322 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2260079
attcgaactcaatcagcatgacagagtgatctccagccttgtcctcgtcaacactcacacctgtgttaagagaatcactgacatgatgtcagctggtccttttgtggcagggctgaaatgcagtggaaatgtttttgggggattcagttaatttgcatggcaaagagggactttgcaattaattgcaattcatctgatcaatcttcataacattctggagtatatgcaaattaccatcagacaaactgaggcagcagactttgtgaaagttaatatttgtgtca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2260079 True 284 lncRNA 0.41 1 34480039 34480322
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504230 LOC106611223 coding downstream 37696 34292468 ~ 34442343 (-)
gphna LOC106611263 coding downstream 244494 34118176 ~ 34235545 (-)
LOC118944181 NA coding downstream 311781 34167460 ~ 34168258 (-)
mpp5a LOC106611266 coding downstream 362192 34073214 ~ 34117847 (-)
eif2s1a if2a coding downstream 407430 34069156 ~ 34072609 (-)
pth2 NA coding upstream 218847 34699169 ~ 34700207 (-)
rin3 LOC106611275 coding upstream 235406 34715728 ~ 34739802 (-)
LOC110505825 LOC106611276 coding upstream 294562 34774884 ~ 34893972 (-)
LOC110504231 LOC106611278 coding upstream 417254 34897576 ~ 34912793 (-)
LOC118944354 LOC106611278 coding upstream 432588 34912910 ~ 34950168 (-)
G1977048 NA non-coding downstream 390 34479213 ~ 34479649 (-)
G1977046 NA non-coding downstream 1230 34477620 ~ 34478809 (-)
G1977030 NA non-coding downstream 24238 34454314 ~ 34455801 (-)
G1977027 NA non-coding downstream 33704 34445779 ~ 34446335 (-)
G1977050 LOC100194703 non-coding upstream 329 34480651 ~ 34481106 (-)
G1977090 NA non-coding upstream 74251 34554573 ~ 34563512 (-)
G1976887 NA non-coding upstream 86592 34566914 ~ 34670890 (-)
G1977175 NA non-coding upstream 261986 34742308 ~ 34742527 (-)
G1975763 NA other downstream 923228 33556430 ~ 33556811 (-)
G1975453 NA other downstream 1155714 33319729 ~ 33324325 (-)
G1974000 NA other downstream 2493155 31986443 ~ 31986884 (-)
G1973835 LOC106611243 other downstream 2861540 31614421 ~ 31618499 (-)
G1977226 NA other upstream 395063 34875385 ~ 34876181 (-)
LOC110505829 LOC106611279 other upstream 489830 34970065 ~ 35000444 (-)
G1977346 NA other upstream 546778 35027100 ~ 35100978 (-)
G1977392 NA other upstream 572728 35053050 ~ 35056926 (-)
G1979142 NA other upstream 1731624 36211946 ~ 36216230 (-)

Expression


G1977049 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1977049 Expression in each Bioproject

Bar chart with 19 bars.
G1977049 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network