G1986751



Basic Information


Item Value
gene id G1986751
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 45694202 ~ 45695201 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2271987
ggagtatcagtgtgatggagtatcagtgtgtgatggagtatcagtgtggtggagtatcagtgtggtggagtatcagtgtgatggagtatcagtgtgatggagtatcagtgtggtggagtatcagtgtgatggagtatcagtgtggtggagtatcagtgtgatggagtatcagtgtgatggagtatcagtgtggtggaatatcagtgtgatggagtatcag

Function


NR:

description
PREDICTED: dynein heavy chain-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2271987 True 220 lncRNA 0.46 3 45694202 45695201

Neighbor


gene id symbol gene type direction distance location
ap5s1 ap5s1 coding upstream 40721 45585850 ~ 45653481 (+)
LOC110513290 cdc25b coding upstream 66963 45608087 ~ 45627239 (+)
LOC110505982 NA coding upstream 416210 45257481 ~ 45278077 (+)
mrps26 mrps26 coding upstream 571427 45117175 ~ 45122775 (+)
dctn1b dctn1 coding upstream 650526 44921935 ~ 45043676 (+)
LOC110512895 LOC105015915 coding downstream 307378 46002579 ~ 46035412 (+)
fgfr3 fgfr3 coding downstream 1088324 46783525 ~ 47007189 (+)
nsd2 whsc1 coding downstream 1489908 47185109 ~ 47256115 (+)
asmt2 LOC106611414 coding downstream 1606489 47301690 ~ 47404080 (+)
pgmrc2 pgmrc2 coding downstream 1733452 47428653 ~ 47444980 (+)
G1986738 NA non-coding upstream 51501 45642157 ~ 45642701 (+)
G1986709 NA non-coding upstream 105549 45587514 ~ 45588653 (+)
G1986657 NA non-coding upstream 158624 45534967 ~ 45535578 (+)
G1986784 NA non-coding downstream 81154 45776355 ~ 45777257 (+)
G1986790 NA non-coding downstream 87560 45782761 ~ 45784738 (+)
G1986803 NA non-coding downstream 125707 45820908 ~ 45821796 (+)
G1986806 NA non-coding downstream 131557 45826758 ~ 45827524 (+)
G1986815 NA non-coding downstream 145449 45840650 ~ 45842493 (+)
G1986701 NA other upstream 36898 45655289 ~ 45657304 (+)
G1986676 NA other upstream 141941 45551691 ~ 45552261 (+)
G1985349 NA other upstream 495465 45167947 ~ 45198737 (+)
G1985341 LOC106611468 other upstream 550841 45139650 ~ 45143361 (+)
G1985304 NA other upstream 629064 45064508 ~ 45065138 (+)
G1986839 NA other downstream 209501 45904702 ~ 45906237 (+)
G1986924 NA other downstream 432766 46127967 ~ 46128518 (+)
G1987065 NA other downstream 805322 46500523 ~ 46500868 (+)
G1987081 NA other downstream 811921 46507122 ~ 46508601 (+)
G1987095 NA other downstream 836464 46526986 ~ 46537264 (+)

Expression


G1986751 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1986751 Expression in each Bioproject

Bar chart with 5 bars.
G1986751 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network