G1986815



Basic Information


Item Value
gene id G1986815
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 45840650 ~ 45842493 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2272075
gtattacatcctgtctgtctgtctggatggtgatgtattacatcctgtctgtctgtctggatggtgatgtattacatcctgtcagtctgtctggatggtgaaatattacatcctgtctgtctggatggtgatgtattacatcctgtcagtctgtctgtctggatggtgatgtattacatcctgtctgtctgtctggatggtgatgtattacatcctgtctgtctggatggtgatgtattacatcctgtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2272075 True 249 lncRNA 0.43 2 45840650 45842493

Neighbor


gene id symbol gene type direction distance location
ap5s1 ap5s1 coding upstream 187169 45585850 ~ 45653481 (+)
LOC110513290 cdc25b coding upstream 213411 45608087 ~ 45627239 (+)
LOC110505982 NA coding upstream 562658 45257481 ~ 45278077 (+)
mrps26 mrps26 coding upstream 717875 45117175 ~ 45122775 (+)
dctn1b dctn1 coding upstream 796974 44921935 ~ 45043676 (+)
LOC110512895 LOC105015915 coding downstream 160086 46002579 ~ 46035412 (+)
fgfr3 fgfr3 coding downstream 941032 46783525 ~ 47007189 (+)
nsd2 whsc1 coding downstream 1342616 47185109 ~ 47256115 (+)
asmt2 LOC106611414 coding downstream 1459197 47301690 ~ 47404080 (+)
pgmrc2 pgmrc2 coding downstream 1586160 47428653 ~ 47444980 (+)
G1986806 NA non-coding upstream 13126 45826758 ~ 45827524 (+)
G1986803 NA non-coding upstream 18854 45820908 ~ 45821796 (+)
G1986790 NA non-coding upstream 55912 45782761 ~ 45784738 (+)
G1986784 NA non-coding upstream 63393 45776355 ~ 45777257 (+)
G1986751 NA non-coding upstream 145449 45694202 ~ 45695201 (+)
G1986823 NA non-coding downstream 10338 45852831 ~ 45880400 (+)
G1986827 NA non-coding downstream 16776 45859269 ~ 45879117 (+)
G1986849 NA non-coding downstream 111419 45953912 ~ 45954321 (+)
G1986903 NA non-coding downstream 234326 46076819 ~ 46077297 (+)
G1986910 NA non-coding downstream 241473 46083966 ~ 46086672 (+)
G1986701 NA other upstream 183346 45655289 ~ 45657304 (+)
G1986676 NA other upstream 288389 45551691 ~ 45552261 (+)
G1985349 NA other upstream 641913 45167947 ~ 45198737 (+)
G1985341 LOC106611468 other upstream 697289 45139650 ~ 45143361 (+)
G1985304 NA other upstream 775512 45064508 ~ 45065138 (+)
G1986839 NA other downstream 62209 45904702 ~ 45906237 (+)
G1986924 NA other downstream 285474 46127967 ~ 46128518 (+)
G1987065 NA other downstream 658030 46500523 ~ 46500868 (+)
G1987081 NA other downstream 664629 46507122 ~ 46508601 (+)
G1987095 NA other downstream 689172 46526986 ~ 46537264 (+)

Expression


G1986815 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1986815 Expression in each Bioproject

Bar chart with 8 bars.
G1986815 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network