LOC118944577



Basic Information


Item Value
gene id LOC118944577
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 33179871 ~ 33180002 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005039929.1
TATGCACCCTAACCCAAAGGCCATATCAAATGAATGGTATGATTTTGTCAGGTGTGCTAAAATCAACATGTACCTTGTCGCCTTTCCCTGAAGCTGCTGTGCCATTGAAAGTGAATTCAAGGTTCAACATTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005039929.1 True 132 mRNA 0.41 1 33179871 33180002
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506114 LOC106562317 coding upstream 21216 33148817 ~ 33158655 (+)
LOC110506669 ext2 coding upstream 279399 32879217 ~ 32900472 (+)
LOC110506667 LOC106562320 coding upstream 301082 32836026 ~ 32878789 (+)
LOC110506663 LOC106562322 coding upstream 350027 32825663 ~ 32829844 (+)
LOC110506662 LOC106587514 coding upstream 360831 32702746 ~ 32819040 (+)
LOC118944571 NA coding downstream 1485 33181487 ~ 33181709 (+)
LOC118944584 NA coding downstream 2008 33182010 ~ 33182137 (+)
LOC110506673 LOC106587517 coding downstream 16131 33196133 ~ 33344864 (+)
LOC110506675 sox6 coding downstream 174726 33354728 ~ 33556537 (+)
LOC110506679 LOC106587531 coding downstream 632549 33812551 ~ 33845325 (+)
G2022153 NA non-coding upstream 34589 33144920 ~ 33145282 (+)
G2022147 NA non-coding upstream 39224 33140438 ~ 33140647 (+)
G2022142 NA non-coding upstream 40703 33136517 ~ 33139168 (+)
G2022136 NA non-coding upstream 104996 33074631 ~ 33074875 (+)
G2022135 NA non-coding upstream 118277 33061297 ~ 33061594 (+)
G2022161 LOC106613263 non-coding downstream 4644 33184646 ~ 33185118 (+)
G2022162 NA non-coding downstream 7283 33187285 ~ 33187585 (+)
G2022163 NA non-coding downstream 7655 33187657 ~ 33187896 (+)
G2022183 NA non-coding downstream 138807 33318809 ~ 33320032 (+)
G2022259 NA non-coding downstream 157505 33337507 ~ 33337851 (+)
LOC110506661 LOC106563545 other upstream 479735 32685823 ~ 32700136 (+)
G2021675 NA other upstream 517631 32661223 ~ 32662240 (+)
G2021178 LOC106563531 other upstream 963708 32214763 ~ 32216163 (+)
G2019882 NA other upstream 2243558 30893278 ~ 30936313 (+)
G2022626 NA other downstream 802715 33982717 ~ 33985845 (+)
tm2d3 tm2d3 other downstream 1711545 34891516 ~ 34896626 (+)
LOC110506714 LOC106562344 other downstream 1816217 34992692 ~ 35036017 (+)
G2024473 LOC106562390 other downstream 2367970 35547972 ~ 35548749 (+)
LOC110506728 cnep1r1 other downstream 2508131 35688053 ~ 35690950 (+)

Expression


LOC118944577 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

LOC118944577 Expression in each Bioproject

Bar chart with 13 bars.
LOC118944577 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network