G1989462



Basic Information


Item Value
gene id G1989462
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 2154090 ~ 2216820 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2275627
ttagtgtgacatagctgagccgatttcaaccagagcctgggtagaccaggcctctctctatcagtttagtgtgacatagctgagcctatttcaaccagagcctggatagACCAGgtctctctctatcagtttagtgtgacatagctgagcctatttaaaacagagcctgggaagaccaggcctcgaacagtttagtgggacaaagctgagcctatttcaaccagagcctgggtagaccaggcctcaaacagtttagtgggacatagctgagcctatttcaaccagaaccTGGATAGACCACgcctctctctatcagtttagtgtgacatagctgagaatatttcaaccagagcctgggagtaccaggcctcgaacagttttgtggaacaaagctgagcctatttcaaccagagcctgggtagaccaggcctcgagcagtttagtgggacatagctgagc
>TU2275628
ttagtgtgacatagctgagccgatttcaaccagagcctgggtagaccaggcctctctctatcagtttagtgtgacatagctgagcctatttcaaccagacctgggtagaccaggccttgagcagtttagtgggacatagctgagcctatttcaaccagagcctgggtagaccaggcctcgaacagtttagtgggacaaagctgagcctatttcaaacagggcctgggtagaccaggccgcgaacagtttagtgtgacatagctgagcctatttcaaccagagcctgggtagagcaggcctcgaacagtttagtgggacatagctgagcctatttcaaccagagcctgggtagacc
>TU2275626
gagcctgggtagacaaggcctcgaacagttttgtgtgacatagctgagcctaattcaaccagagcctgggtaggtagaccaggcctcgaccagtttagtgtgacatagctgagccgatttcaaccagagcctgggtagatcaggcctcgaacagttaagtgggacatagctgagcctatttcaaccagagcctggatagaccaggcctctctctatcagtttagtgtgacatagctgagcctatttcaaccagagcctgggaagaccaggcctcgaacagtttagtgggacatagctgagcctatttcaaccagagcctgggtagagcaggcctcgaacagtttagtgggacatagctgagcctatttcaaccagagcctgggtagacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2275627 False 459 lncRNA 0.49 2 2154090 2170652
TU2275628 False 355 lncRNA 0.52 4 2154090 2216820
TU2275626 True 389 lncRNA 0.52 2 2215328 2216820

Neighbor


gene id symbol gene type direction distance location
LOC110518853 LOC106593614 coding upstream 34542 2106537 ~ 2119548 (+)
LOC110514234 LOC106592435 coding upstream 76407 2023813 ~ 2095560 (+)
LOC110516127 LOC106562400 coding upstream 217711 1931880 ~ 1936379 (+)
LOC110518951 LOC106588123 coding upstream 344970 1802957 ~ 1809120 (+)
LOC110512298 LOC106562814 coding upstream 357805 1784882 ~ 1796285 (+)
LOC118944438 zdhhc1 coding downstream 83379 2300199 ~ 2390150 (+)
LOC118936601 LOC106588035 coding downstream 194641 2411461 ~ 2445866 (+)
LOC118944541 NA coding downstream 407930 2624750 ~ 2625422 (+)
LOC110516197 LOC106588136 coding downstream 905518 3121914 ~ 3321478 (+)
LOC110507004 LOC106588039 coding downstream 1275075 3491895 ~ 3496478 (+)
G1989446 NA non-coding upstream 49126 2104338 ~ 2104964 (+)
G1989441 NA non-coding upstream 62383 2082539 ~ 2091707 (+)
G1989439 NA non-coding upstream 72387 2079859 ~ 2081703 (+)
G1989417 NA non-coding upstream 129243 2024614 ~ 2024847 (+)
G1989414 NA non-coding upstream 136174 2017683 ~ 2017916 (+)
G1989472 NA non-coding downstream 15369 2232189 ~ 2233024 (+)
G1989885 NA non-coding downstream 36442 2253262 ~ 2253513 (+)
G1989897 NA non-coding downstream 147808 2364628 ~ 2366580 (+)
G1989898 NA non-coding downstream 149834 2366654 ~ 2367307 (+)
G1989900 NA non-coding downstream 156379 2373199 ~ 2374948 (+)
G1989393 NA other upstream 178166 1975037 ~ 1975924 (+)
G1989338 NA other upstream 310345 1840690 ~ 1843745 (+)
G1989250 NA other upstream 504501 1625429 ~ 1649589 (+)
G1989958 NA other downstream 254676 2471496 ~ 2483743 (+)
G1989960 NA other downstream 261691 2478511 ~ 2480269 (+)
G1989959 NA other downstream 265366 2482186 ~ 2483541 (+)

Expression


G1989462 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1989462 Expression in each Bioproject

Bar chart with 10 bars.
G1989462 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network