G1990897



Basic Information


Item Value
gene id G1990897
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 3792853 ~ 3794572 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2277511
aacatggctatatacaggaagtaccaggtaataacatggctatatacaggaagtaccaggtaataacatggctatacacaggaagtaccaggtattaacatggctatatacaggaagtaccaggtattaacatggctatatacaggaagtaccaggtaataacatggctatatacaggaagtaccaggtaataacatggctatatacaggaagtaccaggtaataacatgactatatacaggaagtaccaggtaataacatggctatatacagggagtac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2277511 True 280 lncRNA 0.38 2 3792853 3794572
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506223 LOC106588037 coding downstream 300103 3477158 ~ 3492750 (-)
LOC118944414 NA coding downstream 607061 3183940 ~ 3186858 (-)
LOC118944401 LOC106588129 coding downstream 675610 2958963 ~ 3117243 (-)
LOC118944482 LOC106588022 coding downstream 887170 2856093 ~ 2905683 (-)
LOC110516700 LOC106591035 coding upstream 279473 4074045 ~ 4158044 (-)
LOC110498670 anx2a coding upstream 575810 4370382 ~ 4390993 (-)
LOC118944435 LOC106588010 coding upstream 645261 4439833 ~ 4700484 (-)
LOC110526851 vps13c coding upstream 924080 4718652 ~ 4972108 (-)
LOC118944456 NA coding upstream 945344 4739916 ~ 4741747 (-)
G1990895 NA non-coding downstream 7639 3785003 ~ 3785214 (-)
G1990894 NA non-coding downstream 9896 3782726 ~ 3782957 (-)
G1990893 NA non-coding downstream 10283 3781307 ~ 3782570 (-)
G1990890 NA non-coding downstream 20037 3772608 ~ 3772816 (-)
G1990884 NA non-coding downstream 24274 3767785 ~ 3768579 (-)
G1990903 NA non-coding upstream 7970 3802542 ~ 3802766 (-)
G1990909 NA non-coding upstream 22815 3817387 ~ 3818053 (-)
G1990911 NA non-coding upstream 28481 3823053 ~ 3823329 (-)
G1990913 NA non-coding upstream 32480 3827052 ~ 3836792 (-)
G1990919 NA non-coding upstream 60410 3854982 ~ 3857852 (-)
G1990760 LOC100379111 other downstream 277193 3502951 ~ 3515660 (-)
G1990495 LOC106562810 other downstream 504355 3287167 ~ 3288498 (-)
G1990296 NA other downstream 836334 2955410 ~ 2956519 (-)
G1990907 NA other upstream 15633 3810205 ~ 3810560 (-)
G1990926 NA other upstream 78028 3872600 ~ 3873176 (-)
G1990927 LOC106591093 other upstream 80343 3873304 ~ 3880013 (-)

Expression


G1990897 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

G1990897 Expression in each Bioproject

Bar chart with 16 bars.
G1990897 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network