G1992893



Basic Information


Item Value
gene id G1992893
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 6804497 ~ 6810074 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2280451
tggtatagtgtgtctgtccatctagtggtatagtgtgtccatctagtggtatagtgtgtctgtccatctactggtatagtgtgtctgtccatctactggtatagtgtgtccatctactggtatagtgtgtctgtccatctactggtatagtgtgtccatctagtggtatagtgtgtccatctagtggtatagtgtgtctgtccatctactggtatagtgtgtctgtccatctactggtatagtgtgtctgtccatctactggtatagtgtgtccatctagtggtatagtgtgtctgtccatctactggtatagtgtgtctgtccatctactggtatagtgtgtccatctagtggtatagtgtgtctgtccatctactggtatagtgtgtctgtccatctactggtatagtgtgtctgtccatctactggtatagtgtgtctgtccatctactggtatagt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2280451 True 460 lncRNA 0.43 2 6804497 6810074
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936596 LOC106591161 coding downstream 360221 6391414 ~ 6444276 (-)
LOC118944398 NA coding downstream 407477 6394083 ~ 6397020 (-)
LOC118944448 LOC106562861 coding downstream 452171 6345289 ~ 6352326 (-)
LOC118944399 LOC106562864 coding downstream 506271 6145548 ~ 6298226 (-)
LOC110517106 fsd2 coding downstream 705261 6049354 ~ 6099236 (-)
LOC110516490 LOC106588008 coding upstream 13990 6824064 ~ 6830995 (-)
LOC110527018 LOC106587942 coding upstream 192221 7002295 ~ 7039738 (-)
LOC118944479 NA coding upstream 237686 7047760 ~ 7048469 (-)
LOC110506999 LOC105026498 coding upstream 238857 7048931 ~ 7061551 (-)
LOC110507001 LOC106587953 coding upstream 258538 7068612 ~ 7086951 (-)
G1992890 NA non-coding downstream 1023 6802441 ~ 6803474 (-)
G1992889 NA non-coding downstream 2196 6802044 ~ 6802301 (-)
G1992888 NA non-coding downstream 2609 6801445 ~ 6801888 (-)
G1992887 NA non-coding downstream 4917 6798700 ~ 6799580 (-)
G1992881 NA non-coding downstream 32909 6771357 ~ 6771588 (-)
G1992872 NA non-coding upstream 4692 6814766 ~ 6816377 (-)
G1992876 NA non-coding upstream 7949 6818023 ~ 6819999 (-)
G1992875 NA non-coding upstream 10130 6820204 ~ 6820993 (-)
G1993053 NA non-coding upstream 44407 6854481 ~ 6855297 (-)
G1993058 NA non-coding upstream 50450 6860524 ~ 6862867 (-)
G1992485 NA other downstream 815724 5986431 ~ 5988773 (-)
G1992375 NA other downstream 1095813 5708268 ~ 5708684 (-)
G1991846 NA other downstream 1544715 5257722 ~ 5259782 (-)
LOC110515683 LOC105025469 other downstream 1718811 5043780 ~ 5086440 (-)
G1994075 NA other upstream 579171 7389245 ~ 7389568 (-)
LOC118936603 LOC106587968 other upstream 841312 7647283 ~ 7665132 (-)
LOC110526845 LOC106592787 other upstream 939221 7744309 ~ 7751407 (-)
LOC118944558 LOC106595801 other upstream 993770 7802643 ~ 7809933 (-)
LOC110515105 LOC106593850 other upstream 1061108 7863456 ~ 7873075 (-)

Expression


G1992893 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1992893 Expression in each Bioproject

Bar chart with 19 bars.
G1992893 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network