G1992875



Basic Information


Item Value
gene id G1992875
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 6820204 ~ 6820993 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2280426
AGTCTAGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCAGGTCTAGGGAATCATGGTGGTCATCTAGTCTAGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTAGTACTGCTGGTCTAGGAATCATGGTGGTCATCTAGTCTTGTACTGCTGGTCTAGGAATCATGGTGGTCATCTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2280426 True 790 lncRNA 0.47 1 6820204 6820993
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118936596 LOC106591161 coding downstream 375928 6391414 ~ 6444276 (-)
LOC118944398 NA coding downstream 423184 6394083 ~ 6397020 (-)
LOC118944448 LOC106562861 coding downstream 467878 6345289 ~ 6352326 (-)
LOC118944399 LOC106562864 coding downstream 521978 6145548 ~ 6298226 (-)
LOC110517106 fsd2 coding downstream 720968 6049354 ~ 6099236 (-)
LOC110516490 LOC106588008 coding upstream 3071 6824064 ~ 6830995 (-)
LOC110527018 LOC106587942 coding upstream 181302 7002295 ~ 7039738 (-)
LOC118944479 NA coding upstream 226767 7047760 ~ 7048469 (-)
LOC110506999 LOC105026498 coding upstream 227938 7048931 ~ 7061551 (-)
LOC110507001 LOC106587953 coding upstream 247619 7068612 ~ 7086951 (-)
G1992876 NA non-coding downstream 205 6818023 ~ 6819999 (-)
G1992872 NA non-coding downstream 3827 6814766 ~ 6816377 (-)
G1992893 NA non-coding downstream 10130 6804497 ~ 6810074 (-)
G1992890 NA non-coding downstream 16730 6802441 ~ 6803474 (-)
G1992889 NA non-coding downstream 17903 6802044 ~ 6802301 (-)
G1993053 NA non-coding upstream 33488 6854481 ~ 6855297 (-)
G1993058 NA non-coding upstream 39531 6860524 ~ 6862867 (-)
G1993086 NA non-coding upstream 90075 6911068 ~ 6912259 (-)
G1993087 NA non-coding upstream 91638 6912631 ~ 6914261 (-)
G1993088 NA non-coding upstream 93488 6914481 ~ 6914763 (-)
G1992485 NA other downstream 831431 5986431 ~ 5988773 (-)
G1992375 NA other downstream 1111520 5708268 ~ 5708684 (-)
G1991846 NA other downstream 1560422 5257722 ~ 5259782 (-)
LOC110515683 LOC105025469 other downstream 1734518 5043780 ~ 5086440 (-)
G1994075 NA other upstream 568252 7389245 ~ 7389568 (-)
LOC118936603 LOC106587968 other upstream 830393 7647283 ~ 7665132 (-)
LOC110526845 LOC106592787 other upstream 928302 7744309 ~ 7751407 (-)
LOC118944558 LOC106595801 other upstream 982851 7802643 ~ 7809933 (-)
LOC110515105 LOC106593850 other upstream 1050189 7863456 ~ 7873075 (-)

Expression


G1992875 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1992875 Expression in each Bioproject

Bar chart with 21 bars.
G1992875 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network