G1993519



Basic Information


Item Value
gene id G1993519
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 7942552 ~ 7943900 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2281325
GGAGGGGTTATCAGCCTTCAGCTGGTTGTCAGGGAGGAGGGGTCATCAGCCTTCAGCTGGTTGTCAGGGGGGAGGGGTTTCCCCAGGTGGTGTCCGGTGGTGATGCCGTGGGGGCGGGTGCTCTGCTCCTTCCTGACCTCCGGCCGCAGCACGAAGCCCCCGGGGAAGGTCAGGTCAAACATCTCGCTGGGGGCAAAGGTCAGGGGTCGCTCGACCAGCAGGGTCTTCAGCCTGGCCCTCCAGCCATCCAGCATGGCTGTCCGATTCGCGG

Function


NR:

description
NAD(P)H dehydrogenase [quinone] 1-like

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU2281325 True 271 lncRNA 0.66 2 7942552 7943900
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944473 ccl13 coding upstream 17912 7912167 ~ 7924640 (+)
LOC118944472 NA coding upstream 18516 7923140 ~ 7924036 (+)
LOC118944470 ccl13 coding upstream 45533 7895641 ~ 7897019 (+)
LOC110514657 LOC106587975 coding upstream 53178 7888141 ~ 7889374 (+)
LOC110517756 LOC102205661 coding upstream 84062 7835698 ~ 7858490 (+)
LOC110518906 LOC106590762 coding downstream 64432 8008332 ~ 8009868 (+)
LOC110514410 LOC106594039 coding downstream 76478 8020378 ~ 8027928 (+)
LOC110514403 LOC106594039 coding downstream 92451 8036351 ~ 8037930 (+)
LOC110518912 LOC106561181 coding downstream 123281 8067181 ~ 8068719 (+)
LOC110526841 LOC106587964 coding downstream 199837 8143737 ~ 8148499 (+)
G1993413 LOC106587940 non-coding upstream 4837 7926610 ~ 7937715 (+)
G1993415 ccl13 non-coding upstream 18445 7912118 ~ 7924107 (+)
G1993428 NA non-coding upstream 44483 7897237 ~ 7898069 (+)
G1993508 NA non-coding upstream 48052 7894196 ~ 7894500 (+)
G1993505 NA non-coding upstream 59368 7882916 ~ 7883184 (+)
G1993528 NA non-coding downstream 22842 7966742 ~ 7968802 (+)
G1993535 NA non-coding downstream 38572 7982472 ~ 7982757 (+)
G1993547 NA non-coding downstream 61538 8005438 ~ 8005643 (+)
G1993552 NA non-coding downstream 69304 8013204 ~ 8013595 (+)
G1993557 NA non-coding downstream 72760 8016660 ~ 8017120 (+)
G1993435 NA other upstream 232787 7706117 ~ 7709765 (+)
G1993431 NA other upstream 274077 7664992 ~ 7668475 (+)
G1993378 NA other upstream 362144 7566562 ~ 7580408 (+)
G1993364 NA other upstream 414028 7527964 ~ 7552592 (+)
G1993041 NA other upstream 795092 7147197 ~ 7147460 (+)
G1993521 NA other downstream 14877 7958777 ~ 7959464 (+)
G1993550 NA other downstream 94286 8038186 ~ 8042021 (+)
G1993593 LOC106587964 other downstream 199852 8143752 ~ 8148919 (+)
LOC110512379 LOC106587994 other downstream 594039 8537913 ~ 8553492 (+)
G1993771 herc1 other downstream 722701 8666601 ~ 8668267 (+)

Expression


G1993519 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1993519 Expression in each Bioproject

Bar chart with 17 bars.
G1993519 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network