G1994816



Basic Information


Item Value
gene id G1994816
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 9505835 ~ 9506448 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2283180
catcactatgaaacagacatcaccatgaaacagacatcatcatgaaacagacatcaccatgaacagatgaaacagacatcaccatgaaacagacatcaccatgaaacagacatcaccatgaaacagacatcaccatgaaacagacatcaccatgaaacagacatcaccatgaacagatgaaacagacatcatcatgaacagatgaaacagacatcatcatgaacagatgaaacagacatcatcatgaacagacatcaccatgaaacagacatcatcatgaacagacatcaccatgaaacagacatcatcatgaacagacatcaccatgaaacagacatcaccatgaacagatgaaacagacatcatcatgaacagacatcatcatgaaacagacatcaccatgaacagatgaaacagacatcatcatgaacagacatcaccatgaaacagacatcaccatgaacagacatcactatgaaacagacatcaccatgaacag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2283180 True 499 lncRNA 0.39 2 9505835 9506448
Loading

Neighbor


gene id symbol gene type direction distance location
klf13 LOC105021104 coding upstream 271832 9173028 ~ 9234003 (+)
LOC118936595 LOC106609700 coding upstream 490348 8982115 ~ 9015487 (+)
LOC118944396 idh3a coding upstream 524212 8964942 ~ 8981623 (+)
LOC118944518 LOC106609706 coding upstream 612675 8880465 ~ 8893160 (+)
LOC118944519 NA coding upstream 671004 8832283 ~ 8834831 (+)
LOC110526863 LOC106562818 coding downstream 33838 9540286 ~ 9543273 (+)
si:ch211-266g18.10 LOC106561896 coding downstream 201006 9707454 ~ 9812098 (+)
LOC110506241 LOC106561900 coding downstream 339479 9845927 ~ 9918295 (+)
LOC110506240 NA coding downstream 438361 9944809 ~ 9965961 (+)
gnmt gnmt coding downstream 762503 10268951 ~ 10282107 (+)
G1994810 NA non-coding upstream 5817 9499793 ~ 9500018 (+)
G1994805 NA non-coding upstream 20810 9484800 ~ 9485025 (+)
G1994797 NA non-coding upstream 34400 9470961 ~ 9471435 (+)
G1994779 NA non-coding upstream 73781 9431762 ~ 9432054 (+)
G1994773 NA non-coding upstream 84071 9421459 ~ 9421764 (+)
G1994827 NA non-coding downstream 18519 9524967 ~ 9525369 (+)
G1994848 NA non-coding downstream 51662 9558110 ~ 9559723 (+)
G1994851 NA non-coding downstream 54275 9560723 ~ 9566154 (+)
G1994894 NA non-coding downstream 92187 9598635 ~ 9602550 (+)
G1994896 NA non-coding downstream 96353 9602801 ~ 9603033 (+)
G1994757 LOC106613263 other upstream 114902 9390568 ~ 9390933 (+)
G1993783 NA other upstream 807712 8697174 ~ 8698123 (+)
G1993771 herc1 other upstream 837568 8666601 ~ 8668267 (+)
LOC110512379 LOC106587994 other upstream 954468 8537913 ~ 8553492 (+)
G1993593 LOC106587964 other upstream 1357336 8143752 ~ 8148919 (+)
G1998628 NA other downstream 3715589 13222037 ~ 13222681 (+)
G2002614 NA other downstream 6183320 15689768 ~ 15696280 (+)
LOC110506284 LOC106561914 other downstream 6288684 15734525 ~ 15800073 (+)
G2002823 NA other downstream 6565539 16071987 ~ 16074044 (+)

Expression


G1994816 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1994816 Expression in each Bioproject

Bar chart with 8 bars.
G1994816 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network