G1994894



Basic Information


Item Value
gene id G1994894
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 9598635 ~ 9602550 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2283282
aatactctggacctataatagactgttttaaaggggaatgctctggacctataataatactctggacctataatagactgttttaaaggggaatgctctggacctataataatactctggacctataatagactgttttaaaggtgaatgctctggacctataataatactctggacctataatagactgttttaaaggtgaatgctctggacctataataatactctggacctataatatactgttttaaaggggaatactctggacctataata
>TU2283283
aatactctggacctataatagactgttttaaaggggaatgctctggacctataataatactctggacctataatagactgttttaaaggggaatgctctggacctataataatactctggacctataatagactgttttaaaggtgaatgctctggacctataataatactctggacctataatagactgttttaaaggggaatgctctggacctataatatactgttttaaagggtgaatactctggacctataataatactctggacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2283282 False 276 lncRNA 0.35 2 9598635 9600205
TU2283283 True 270 lncRNA 0.36 2 9598635 9602550

Neighbor


gene id symbol gene type direction distance location
LOC110526863 LOC106562818 coding upstream 55362 9540286 ~ 9543273 (+)
klf13 LOC105021104 coding upstream 364632 9173028 ~ 9234003 (+)
LOC118936595 LOC106609700 coding upstream 583148 8982115 ~ 9015487 (+)
LOC118944396 idh3a coding upstream 617012 8964942 ~ 8981623 (+)
LOC118944518 LOC106609706 coding upstream 705475 8880465 ~ 8893160 (+)
si:ch211-266g18.10 LOC106561896 coding downstream 104904 9707454 ~ 9812098 (+)
LOC110506241 LOC106561900 coding downstream 243377 9845927 ~ 9918295 (+)
LOC110506240 NA coding downstream 342259 9944809 ~ 9965961 (+)
gnmt gnmt coding downstream 666401 10268951 ~ 10282107 (+)
daam2 daam2 coding downstream 1412449 11014999 ~ 11241714 (+)
G1994851 NA non-coding upstream 36220 9560723 ~ 9566154 (+)
G1994848 NA non-coding upstream 38912 9558110 ~ 9559723 (+)
G1994827 NA non-coding upstream 73266 9524967 ~ 9525369 (+)
G1994815 NA non-coding upstream 90061 9505775 ~ 9508574 (+)
G1994816 NA non-coding upstream 92187 9505835 ~ 9506448 (+)
G1994896 NA non-coding downstream 251 9602801 ~ 9603033 (+)
G1994906 NA non-coding downstream 12350 9614900 ~ 9616129 (+)
G1994917 NA non-coding downstream 23400 9625950 ~ 9626258 (+)
G1994919 NA non-coding downstream 24439 9626989 ~ 9627839 (+)
G1994941 NA non-coding downstream 43380 9645930 ~ 9650781 (+)
G1994757 LOC106613263 other upstream 207702 9390568 ~ 9390933 (+)
G1993783 NA other upstream 900512 8697174 ~ 8698123 (+)
G1993771 herc1 other upstream 930368 8666601 ~ 8668267 (+)
LOC110512379 LOC106587994 other upstream 1047268 8537913 ~ 8553492 (+)
G1998628 NA other downstream 3619487 13222037 ~ 13222681 (+)
G2002614 NA other downstream 6087218 15689768 ~ 15696280 (+)
LOC110506284 LOC106561914 other downstream 6192582 15734525 ~ 15800073 (+)
G2002823 NA other downstream 6469437 16071987 ~ 16074044 (+)
fshb LOC100136594 other downstream 7009935 16609650 ~ 16614319 (+)

Expression


G1994894 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1994894 Expression in each Bioproject

Bar chart with 5 bars.
G1994894 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network