G1999856



Basic Information


Item Value
gene id G1999856
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 13337335 ~ 13338151 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2288512
cgctttgaggacaatacagtgccactgacacggcctgcaacgaaaacatgcggtctctccttcactgcagccgaggtgagtaagacatttaaacgtattaaccctcgcaaggctgcaggcccagatggcatccccagccgcgccctcagagcatgcgcagaccagctggccggtgtgtttacggacatattcaatcaatccttatcccagtctgctgttcccacatgcttcaagagggccaccattgttcctgttcccaagaaagctaaggtaactgagctaaacgactaccgccccgtagcactcacttccgtcatcatgaagtgctttgagagactagtcaaggaccatatcacctccaccctacccgacaccctagacccactccaatttgattaccgcccaaataggtccacagaccatgcaatctcaaccacactgcacactgccctaacccatcaagacaagaggaatacctatgtgagaatgctgttcatcgactacagctcggcattcaacaccatagtaccctccaagctcgtcatcaagctcgagaccctgggtctcgaccccgccctgtgcaactgggtactggacttcctgacgggccgcccccagatggtgagggtaggcaacaacatctccaccccgctgatcctcaacactggggccccacaagggtacgttctgagccctctcctgtactccctgttcacccacgactgcgtggccacgcacgcctccaactcaatcatcaagtttgcggacgacacaacagtggtaggcttgattaccaacaacgacgagacggcctaca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2288512 True 817 TUCP 0.54 1 13337335 13338151

Neighbor


gene id symbol gene type direction distance location
trmt61b trmt61b coding downstream 480671 12845479 ~ 12856664 (-)
LOC110506264 LOC106561878 coding downstream 502046 12776493 ~ 12835289 (-)
LOC118944583 NA coding downstream 545290 12791911 ~ 12792045 (-)
LOC118944582 NA coding downstream 555809 12781392 ~ 12781526 (-)
LOC110506260 LOC106561879 coding downstream 596392 12715303 ~ 12740943 (-)
LOC110506271 LOC106561903 coding upstream 980153 14318304 ~ 14368873 (-)
LOC110506081 prmt3 coding upstream 1039267 14377418 ~ 14496552 (-)
LOC110506276 LOC106587060 coding upstream 1275435 14613586 ~ 14678505 (-)
LOC110506082 LOC106561908 coding upstream 1364957 14703108 ~ 14788733 (-)
LOC110506277 NA coding upstream 1556344 14894495 ~ 14898577 (-)
G1999852 NA non-coding downstream 5144 13331919 ~ 13332191 (-)
G1999842 NA non-coding downstream 24627 13312487 ~ 13312708 (-)
G1999834 NA non-coding downstream 41808 13295059 ~ 13295527 (-)
G1999819 NA non-coding downstream 57035 13280030 ~ 13280300 (-)
G1999802 NA non-coding downstream 82907 13254224 ~ 13254428 (-)
G1999858 LOC107575789 non-coding upstream 2145 13340296 ~ 13340781 (-)
G1999962 NA non-coding upstream 153456 13491607 ~ 13511200 (-)
G1999974 NA non-coding upstream 173874 13512025 ~ 13512490 (-)
G1999981 LOC106572279 non-coding upstream 183947 13522098 ~ 13523022 (-)
G2000024 NA non-coding upstream 245072 13583223 ~ 13584752 (-)
G1996949 NA other downstream 1919000 11418099 ~ 11418335 (-)
G1996632 NA other downstream 2412802 10922016 ~ 10924533 (-)
G1994812 NA other downstream 3835682 9500716 ~ 9501653 (-)
G1994786 NA other downstream 3888841 9447593 ~ 9448494 (-)
G1994674 NA other downstream 4156630 9177038 ~ 9180705 (-)
G1999980 LOC106561221 other upstream 182535 13520686 ~ 13521520 (-)
G2000052 NA other upstream 291633 13629784 ~ 13630075 (-)
G2000879 NA other upstream 939990 14278141 ~ 14278746 (-)
G2003219 LOC106561912 other upstream 2377397 15715548 ~ 15718308 (-)

Expression


G1999856 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1999856 Expression in each Bioproject

Bar chart with 20 bars.
G1999856 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network