G2003529



Basic Information


Item Value
gene id G2003529
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 16259854 ~ 16260361 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2292471
gctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcctcccatcaattttaaccatcttccctgtccctgctgtgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacgaca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2292471 True 470 lncRNA 0.44 2 16259854 16260361

Neighbor


gene id symbol gene type direction distance location
nav2a LOC106587075 coding downstream 48826 15900960 ~ 16211028 (-)
LOC110506224 LOC106561917 coding downstream 427687 15828591 ~ 15832167 (-)
LOC110506287 LOC106587073 coding downstream 440824 15816845 ~ 15819030 (-)
LOC110506286 LOC106561915 coding downstream 450120 15800492 ~ 15809734 (-)
LOC110506281 LOC106561910 coding downstream 1112336 15112569 ~ 15147518 (-)
LOC110506294 LOC106561926 coding upstream 150453 16410814 ~ 16440543 (-)
LOC110506295 LOC106561927 coding upstream 181461 16441822 ~ 16451843 (-)
LOC110506296 LOC106587087 coding upstream 296917 16557278 ~ 16595414 (-)
arl14ep LOC106561931 coding upstream 354421 16614782 ~ 16617168 (-)
bbox1 LOC106561934 coding upstream 485850 16746211 ~ 16771997 (-)
LOC110506292 LOC106561923 non-coding downstream 19987 16235517 ~ 16269616 (-)
G2003474 NA non-coding downstream 34777 16223801 ~ 16225077 (-)
G2003470 NA non-coding downstream 105253 16154384 ~ 16154601 (-)
G2003469 NA non-coding downstream 105669 16153973 ~ 16154185 (-)
G2003467 NA non-coding downstream 108838 16150802 ~ 16151016 (-)
G2003574 NA non-coding upstream 59986 16320347 ~ 16320938 (-)
G2003585 NA non-coding upstream 135101 16395462 ~ 16469974 (-)
G2003702 NA non-coding upstream 251670 16512031 ~ 16512248 (-)
G2003728 NA non-coding upstream 275608 16535969 ~ 16536349 (-)
G2003881 NA non-coding upstream 524216 16784577 ~ 16785359 (-)
G2003219 LOC106561912 other downstream 541546 15715548 ~ 15718308 (-)
LOC110506276 LOC106587060 other downstream 1626246 14613586 ~ 14678505 (-)
G2000879 NA other downstream 1981108 14278141 ~ 14278746 (-)
G2000052 NA other downstream 2629779 13629784 ~ 13630075 (-)
G2003819 LOC106561933 other upstream 460630 16720991 ~ 16723682 (-)
G2005166 NA other upstream 1627084 17887445 ~ 17890081 (-)
G2005456 LOC106561978 other upstream 1933749 18194110 ~ 18199589 (-)
G2005584 NA other upstream 1973913 18234274 ~ 18234536 (-)
G2009991 NA other upstream 5373918 21634279 ~ 21634592 (-)

Expression


G2003529 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2003529 Expression in each Bioproject

Bar chart with 12 bars.
G2003529 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network