G2012356



Basic Information


Item Value
gene id G2012356
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 23510381 ~ 23514325 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2301962
aaactgaacatttgctatctaactgagcgtctcctcattgaaaacatccgaagttcttcaaaggtaaatgattttatttgaatgcttttcttgtttttgtgaaaatgttgcctgctgaatgctaggcttaatgctatgctagctatcaatactcttacacaaatgcttgtgtagctatggttgaaaagcatattttgaaaatctgagatgacagtgttgttaacaaaaggctaagcttgtgagtgaatatatttctttcatttcatttgcgattttcatgaatagttaacgttgcgttatggtaatgagtttgatgattacgctcccggatacgggattgctcgacgcaagaagttaaggagaggtatatctataatttcATGTGTATacc
>TU2301961
aaactgaacatttgctatctaactgagcgtctcctcattgaaaacatccgaagttcttcaaaggtaaatgattttatttgaatgcttttcttgtttttgtgaaaatgttgcctgctgaatgctaggcttaatgctatgctagctatcaatactcttacacaaatgcttgtgtagctatggttgaaaagcatattttgaaaatctgagatgacagtgttgttaacaaaaggctaagcttgtgagtgaatatatttctttcatttgcgattttcatgaatagttaacgttgcgttatggta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2301962 False 391 lncRNA 0.35 2 23510381 23514325
TU2301961 True 299 lncRNA 0.34 2 23510473 23514325
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506435 LOC106562152 coding downstream 234124 23268976 ~ 23276257 (-)
mphosph10 LOC106562155 coding downstream 334301 23170702 ~ 23176080 (-)
ist1 LOC106562157 coding downstream 340441 23160200 ~ 23169940 (-)
LOC110506427 dhodh coding downstream 370306 23131212 ~ 23140075 (-)
LOC110506425 LOC106581595 coding downstream 425628 23081788 ~ 23084753 (-)
LOC110506443 LOC106562147 coding upstream 214674 23728999 ~ 23757041 (-)
LOC110506445 LOC106562146 coding upstream 280969 23795294 ~ 23921670 (-)
LOC110506447 LOC106562145 coding upstream 420300 23934625 ~ 23998406 (-)
LOC110506449 LOC106562143 coding upstream 540942 24055267 ~ 24080074 (-)
LOC110506451 NA coding upstream 758124 24272449 ~ 24274128 (-)
G2012312 NA non-coding downstream 6485 23446749 ~ 23503896 (-)
G2012308 LOC106562151 non-coding downstream 69133 23437297 ~ 23441248 (-)
G2012297 NA non-coding downstream 99089 23410589 ~ 23411292 (-)
G2011703 NA non-coding downstream 245889 23264280 ~ 23264492 (-)
G2012370 NA non-coding upstream 20689 23535014 ~ 23535218 (-)
G2012381 NA non-coding upstream 37404 23551729 ~ 23551965 (-)
G2012383 NA non-coding upstream 41765 23556090 ~ 23556390 (-)
G2012398 NA non-coding upstream 84343 23598668 ~ 23598970 (-)
G2012411 NA non-coding upstream 114713 23629038 ~ 23629292 (-)
G2011712 LOC106587247 other downstream 263242 23245784 ~ 23247139 (-)
lto1 oraov1 other downstream 1104894 22402983 ~ 22405876 (-)
G2009991 NA other downstream 1875789 21634279 ~ 21634592 (-)
G2005584 NA other downstream 5275845 18234274 ~ 18234536 (-)
G2005456 LOC106561978 other downstream 5310792 18194110 ~ 18199589 (-)
G2012712 NA other upstream 691955 24206280 ~ 24222078 (-)
LOC110506455 LOC106562138 other upstream 981988 24486973 ~ 24599682 (-)
G2013483 NA other upstream 1335945 24850270 ~ 24850636 (-)
LOC110506491 LOC106562111 other upstream 2161362 25675687 ~ 25681379 (-)
G2014702 LOC106562103 other upstream 2213327 25727652 ~ 25730380 (-)

Expression


G2012356 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2012356 Expression in each Bioproject

Bar chart with 18 bars.
G2012356 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network