G2015662



Basic Information


Item Value
gene id G2015662
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 26594060 ~ 26594630 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2305577
ggactgagcacacacactgaggggcccacgtgttgaggatcagcgtggcagatgtgttgttacttacccttacgagtgcggcccgtcaggaagtccaggatccagttgcagagggaggtgtttagtcccatggtccttagcttagtgatgagctttgagggcactatggtgttgaacgctgagctgtagtcaatgaatagcattctcacgtagatgttccttttgtccaggtgggaaagggcagtgtggagtgctatagagattgcgtcatctgtggatctgttggggcggtatgcaatttggagtgggtcttgtgtttctgggataatggttttgatgtgagccatgaccagcctttcaaagtacttcatggctacagatgtgagtgctatgggtcagtaatcatttaggcaggttaccctggtgttcttgggcaaagggactatggtggtctgcttgaaacatgttgctattacagactcagtcagggacaggttgaaaatgtcagtgaagacacttgccagttggtcagcgcatgcttagagtacacgtcctggtaatccgtctgacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2305577 True 571 lncRNA 0.50 1 26594060 26594630

Neighbor


gene id symbol gene type direction distance location
psmd7 LOC106587187 coding downstream 252137 26336554 ~ 26341923 (-)
LOC110506506 LOC101448035 coding downstream 305373 26280732 ~ 26288687 (-)
bola3 bola3 coding downstream 317229 26272579 ~ 26276831 (-)
LOC110506505 LOC106562097 coding downstream 324860 26238635 ~ 26269200 (-)
clec3a LOC106562113 coding downstream 359037 26233109 ~ 26235023 (-)
LOC110506517 LOC106562084 coding upstream 31543 26626173 ~ 26907118 (-)
LOC110506519 zfhx3 coding upstream 339208 26933838 ~ 27127646 (-)
LOC118944563 NA coding upstream 593687 27188317 ~ 27189379 (-)
LOC118944564 NA coding upstream 675818 27270448 ~ 27276437 (-)
LOC118944565 NA coding upstream 749857 27344487 ~ 27349649 (-)
G2015651 NA non-coding downstream 15264 26578569 ~ 26578796 (-)
G2015447 NA non-coding downstream 57848 26531288 ~ 26536212 (-)
G2015446 NA non-coding downstream 59881 26529118 ~ 26534179 (-)
G2015445 NA non-coding downstream 61390 26522946 ~ 26532670 (-)
G2015440 NA non-coding downstream 75406 26518405 ~ 26518654 (-)
G2015680 NA non-coding upstream 21295 26615925 ~ 26618166 (-)
G2015694 NA non-coding upstream 37602 26632232 ~ 26632437 (-)
G2015695 NA non-coding upstream 38322 26632952 ~ 26633228 (-)
G2015696 NA non-coding upstream 39787 26634417 ~ 26634789 (-)
G2014702 LOC106562103 other downstream 863680 25727652 ~ 25730380 (-)
LOC110506491 LOC106562111 other downstream 913162 25675687 ~ 25681379 (-)
G2013483 NA other downstream 1743424 24850270 ~ 24850636 (-)
LOC110506455 LOC106562138 other downstream 2097252 24486973 ~ 24599682 (-)
G2015668 NA other upstream 7149 26601779 ~ 26602259 (-)
G2015718 NA other upstream 90719 26685349 ~ 26735236 (-)
G2015737 NA other upstream 184109 26778739 ~ 26784661 (-)
G2016013 NA other upstream 491300 27085930 ~ 27086265 (-)
G2017021 NA other upstream 1483267 28077897 ~ 28078556 (-)

Expression


G2015662 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2015662 Expression in each Bioproject

Bar chart with 20 bars.
G2015662 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network