G2020011



Basic Information


Item Value
gene id G2020011
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 31148104 ~ 31148325 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2310387
CATACTCTAGCTTCTAATTCTGCATATGGACCCCATAGAATAACATGATTTCTGTCATCTGACCCTGAAACAAGTCTCCAGTGATCTCAAACGATGCCATTATATCCATAGCAGCTCATACGCTTATATGCAAATGAACCCAAAAACTATTGTAGAGCGTCTATGCCCATATTTTCCCTCTAGTCTTTTGTTTGGGGTTACCTGCTCATGGAAAGACACAGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2310387 True 222 lncRNA 0.41 1 31148104 31148325
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506620 cmc2 coding upstream 592064 30551509 ~ 30556040 (+)
LOC110506615 LOC106587442 coding upstream 666283 30478555 ~ 30481821 (+)
LOC110506613 psf2 coding upstream 1144007 30001053 ~ 30004097 (+)
LOC110506612 LOC106587369 coding upstream 1151596 29993772 ~ 29996508 (+)
LOC110506610 LOC107388308 coding upstream 1157585 29989755 ~ 29990519 (+)
LOC100136122 LOC100169858 coding downstream 666316 31814641 ~ 31822927 (+)
LOC110506638 LOC106562311 coding downstream 931590 32079915 ~ 32087772 (+)
LOC110506639 LOC106563533 coding downstream 997855 32146180 ~ 32165255 (+)
LOC110506640 pkp3 coding downstream 1031405 32179730 ~ 32196429 (+)
LOC110506644 NA coding downstream 1070743 32219068 ~ 32246388 (+)
G2019985 NA non-coding upstream 2099 31144327 ~ 31146005 (+)
G2019928 NA non-coding upstream 157660 30987455 ~ 30990444 (+)
G2019923 NA non-coding upstream 175136 30972751 ~ 30972968 (+)
G2019882 NA non-coding upstream 211791 30893278 ~ 30936313 (+)
G2019810 NA non-coding upstream 341234 30806606 ~ 30806870 (+)
G2020012 NA non-coding downstream 314 31148639 ~ 31148926 (+)
G2020013 NA non-coding downstream 615 31148940 ~ 31149157 (+)
G2020022 NA non-coding downstream 14912 31163237 ~ 31163469 (+)
G2020023 NA non-coding downstream 15667 31163992 ~ 31164225 (+)
G2020026 NA non-coding downstream 17901 31166226 ~ 31166546 (+)
G2019478 NA other upstream 619696 30524635 ~ 30528408 (+)
G2019479 NA other upstream 629511 30517167 ~ 30518593 (+)
G2019067 NA other upstream 749886 30397840 ~ 30398218 (+)
G2018959 NA other upstream 928985 30218599 ~ 30219119 (+)
G2021178 LOC106563531 other downstream 1066438 32214763 ~ 32216163 (+)
G2021675 NA other downstream 1512898 32661223 ~ 32662240 (+)
LOC110506661 LOC106563545 other downstream 1537498 32685823 ~ 32700136 (+)
LOC110506662 LOC106587514 other downstream 1554682 32702746 ~ 32819040 (+)
G2022626 NA other downstream 2834392 33982717 ~ 33985845 (+)

Expression


G2020011 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2020011 Expression in each Bioproject

Bar chart with 8 bars.
G2020011 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network