G2022062



Basic Information


Item Value
gene id G2022062
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 32927315 ~ 32927655 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2312784
ATTTCAGACCACCCATGCAATATTTTTACATAAACTATGAGTGTGAGATTGTGCAAAATTTGCTTAATTGATGACATCGCATTTTCATGTAGCCTAATTATGTCTTACTACCCTGTCATCACCACTTCACTTGTAGGTTTTAGGAGGGTGTCAGTCTCGTTTCCAAGCTCATTACCCATGAACTACACCGTGAACATTCAGCGATCAAAGAACCATGTTGTTGCAGATAGCCTACTGCAGAGATATTTTACGCGGAATATTTTTCACCAGAGGGGCTTTATACAGCAACTCCCTGTAGTAAGATTGTAGCCCAATAGCCATATGTTCAATGCTTAATACAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2312784 True 341 lncRNA 0.40 1 32927315 32927655

Neighbor


gene id symbol gene type direction distance location
LOC110506670 LOC106587508 coding downstream 1048 32900561 ~ 32926267 (-)
LOC110506665 polr2l coding downstream 96200 32829426 ~ 32831115 (-)
LOC110506664 sdhaf2 coding downstream 101566 32823041 ~ 32825749 (-)
LOC110506653 LOC106563521 coding downstream 341676 32528233 ~ 32585639 (-)
LOC110506651 LOC106587483 coding downstream 494854 32405119 ~ 32432461 (-)
nucb2a LOC106562318 coding upstream 231687 33159342 ~ 33168228 (-)
LOC118944422 NA coding upstream 459197 33386852 ~ 33388945 (-)
LOC100136595 calc1 coding upstream 873679 33800216 ~ 33815643 (-)
LOC110506676 pde3b coding upstream 918355 33846010 ~ 33927989 (-)
LOC110506684 LOC106587537 coding upstream 1186854 34109965 ~ 34118269 (-)
G2022053 NA non-coding downstream 32928 32893882 ~ 32894387 (-)
G2022016 LOC106587514 non-coding downstream 117343 32809410 ~ 32809972 (-)
G2022015 NA non-coding downstream 118167 32808935 ~ 32809148 (-)
G2022014 LOC106587514 non-coding downstream 118870 32808137 ~ 32808445 (-)
G2022071 NA non-coding upstream 11752 32939407 ~ 32939632 (-)
G2022091 NA non-coding upstream 33481 32961136 ~ 32961394 (-)
G2022109 NA non-coding upstream 53246 32980901 ~ 32981243 (-)
G2022110 NA non-coding upstream 53714 32981369 ~ 32981633 (-)
G2022117 NA non-coding upstream 55831 32983486 ~ 33002037 (-)
G2022042 LOC106562320 other downstream 48544 32875255 ~ 32878771 (-)
G2021975 NA other downstream 92834 32831627 ~ 32834481 (-)
G2021979 NA other downstream 108335 32810623 ~ 32818980 (-)
G2021956 NA other downstream 210402 32716126 ~ 32716913 (-)
LOC110506691 LOC106562361 other upstream 1573198 34499589 ~ 34523950 (-)
G2024673 NA other upstream 1948767 34876422 ~ 34928381 (-)
G2024949 NA other upstream 2468419 35396074 ~ 35399967 (-)
G2025061 NA other upstream 2568132 35495787 ~ 35497803 (-)

Expression


G2022062 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2022062 Expression in each Bioproject

Bar chart with 3 bars.
G2022062 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network