G2022136



Basic Information


Item Value
gene id G2022136
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 33074631 ~ 33074875 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2312862
agatgtatttttttttgtttcttactttttcaaagtcactgtgcatttggaatatgttttaatgggcaggtaccatcacgaatttgtttatcgaatttgtttatgtttccttactttttcaaagtcactgtgcatttgcaatatgttttaatgggcaggtaccatcacgaatttgtttatcgaatttgtttatgtttccttactttttcaaagtcactgtgcatttgcaatatgtttcaatgggc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2312862 True 245 lncRNA 0.32 1 33074631 33074875
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506669 ext2 coding upstream 174159 32879217 ~ 32900472 (+)
LOC110506667 LOC106562320 coding upstream 195842 32836026 ~ 32878789 (+)
LOC110506663 LOC106562322 coding upstream 244787 32825663 ~ 32829844 (+)
LOC110506662 LOC106587514 coding upstream 255591 32702746 ~ 32819040 (+)
LOC110506661 LOC106563545 coding upstream 375935 32685823 ~ 32700136 (+)
LOC110506114 LOC106562317 coding downstream 73942 33148817 ~ 33158655 (+)
LOC110506672 rps13 coding downstream 103000 33177875 ~ 33182436 (+)
LOC118944577 NA coding downstream 104996 33179871 ~ 33180002 (+)
LOC118944571 NA coding downstream 106612 33181487 ~ 33181709 (+)
LOC118944584 NA coding downstream 107135 33182010 ~ 33182137 (+)
G2022135 NA non-coding upstream 13037 33061297 ~ 33061594 (+)
G2022132 NA non-coding upstream 17709 33056327 ~ 33056922 (+)
G2022131 NA non-coding upstream 18675 33055603 ~ 33055956 (+)
G2022129 NA non-coding upstream 32755 33041626 ~ 33041876 (+)
G2022126 NA non-coding upstream 43545 33030792 ~ 33031086 (+)
G2022142 NA non-coding downstream 61642 33136517 ~ 33139168 (+)
G2022147 NA non-coding downstream 65563 33140438 ~ 33140647 (+)
G2022153 NA non-coding downstream 70045 33144920 ~ 33145282 (+)
G2022161 LOC106613263 non-coding downstream 109771 33184646 ~ 33185118 (+)
G2022162 NA non-coding downstream 112410 33187285 ~ 33187585 (+)
G2021675 NA other upstream 412391 32661223 ~ 32662240 (+)
G2021178 LOC106563531 other upstream 858468 32214763 ~ 32216163 (+)
G2019882 NA other upstream 2138318 30893278 ~ 30936313 (+)
G2022626 NA other downstream 907842 33982717 ~ 33985845 (+)
tm2d3 tm2d3 other downstream 1816672 34891516 ~ 34896626 (+)
LOC110506714 LOC106562344 other downstream 1921344 34992692 ~ 35036017 (+)
G2024473 LOC106562390 other downstream 2473097 35547972 ~ 35548749 (+)
LOC110506728 cnep1r1 other downstream 2613258 35688053 ~ 35690950 (+)

Expression


G2022136 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2022136 Expression in each Bioproject

Bar chart with 12 bars.
G2022136 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network