G2022153



Basic Information


Item Value
gene id G2022153
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 33144920 ~ 33145282 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2312879
accgtcatcttgaacttcttccattttctaataattgcgccaacagttgttgccttctcaccaagctgcttgcctattgtcctgtagccaatcccagccttgtgcaggtctacaattgtatccctgatgtccttacacagctctctggtcttggccattgtggagaggttggagtctgtttgattgagtgtgtggacaggtatcttttatacaggtaacgagttcaaacaggtgcagttaatacagataatgagtggagaacaggagggatttttaaagaaaaactaacaggtctgtgagagcaagaattcttactggttggtaggtgatcaaatacttatgtcatgcaataaaatgcaaatt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2312879 True 363 lncRNA 0.42 1 33144920 33145282

Neighbor


gene id symbol gene type direction distance location
LOC110506669 ext2 coding upstream 244448 32879217 ~ 32900472 (+)
LOC110506667 LOC106562320 coding upstream 266131 32836026 ~ 32878789 (+)
LOC110506663 LOC106562322 coding upstream 315076 32825663 ~ 32829844 (+)
LOC110506662 LOC106587514 coding upstream 325880 32702746 ~ 32819040 (+)
LOC110506661 LOC106563545 coding upstream 446224 32685823 ~ 32700136 (+)
LOC110506114 LOC106562317 coding downstream 3535 33148817 ~ 33158655 (+)
LOC110506672 rps13 coding downstream 32593 33177875 ~ 33182436 (+)
LOC118944577 NA coding downstream 34589 33179871 ~ 33180002 (+)
LOC118944571 NA coding downstream 36205 33181487 ~ 33181709 (+)
LOC118944584 NA coding downstream 36728 33182010 ~ 33182137 (+)
G2022147 NA non-coding upstream 4273 33140438 ~ 33140647 (+)
G2022142 NA non-coding upstream 5752 33136517 ~ 33139168 (+)
G2022136 NA non-coding upstream 70045 33074631 ~ 33074875 (+)
G2022135 NA non-coding upstream 83326 33061297 ~ 33061594 (+)
G2022132 NA non-coding upstream 87998 33056327 ~ 33056922 (+)
G2022161 LOC106613263 non-coding downstream 39364 33184646 ~ 33185118 (+)
G2022162 NA non-coding downstream 42003 33187285 ~ 33187585 (+)
G2022163 NA non-coding downstream 42375 33187657 ~ 33187896 (+)
G2022183 NA non-coding downstream 173527 33318809 ~ 33320032 (+)
G2022259 NA non-coding downstream 192225 33337507 ~ 33337851 (+)
G2021675 NA other upstream 482680 32661223 ~ 32662240 (+)
G2021178 LOC106563531 other upstream 928757 32214763 ~ 32216163 (+)
G2019882 NA other upstream 2208607 30893278 ~ 30936313 (+)
G2022626 NA other downstream 837435 33982717 ~ 33985845 (+)
tm2d3 tm2d3 other downstream 1746265 34891516 ~ 34896626 (+)
LOC110506714 LOC106562344 other downstream 1850937 34992692 ~ 35036017 (+)
G2024473 LOC106562390 other downstream 2402690 35547972 ~ 35548749 (+)
LOC110506728 cnep1r1 other downstream 2542851 35688053 ~ 35690950 (+)

Expression


G2022153 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2022153 Expression in each Bioproject

Bar chart with 20 bars.
G2022153 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network