G2022726



Basic Information


Item Value
gene id G2022726
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 33173364 ~ 33173670 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2313518
GACGAGTTAGCGGAGCCCCTGGTGGGGCTATGGTTGGGCTGAGGGCTCCGGCTCGAAATGGGCAACAGCCATCAACCATTATTATGGGAAGCTCCATGGTTGGATTGGTGGAAGTCTGAAATACCCGTACACTTTGTTTTCCTGGAGCTAGGGTATTGGAGTTATTAGAAGTCATGCCCACCATCAAGAAACAGATTCCTGCTCTGAAAACAGTTGTGTTGTATATTGGGTCTAATGATATTATATGTGTGAAATCTGTAAAGTTAAAAGACAATTTCTTAAAGCTCTTGGAGAATGCTCATTAATT

Function


NR:

description
uncharacterized protein LOC111190062

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2313518 True 307 lncRNA 0.43 1 33173364 33173670
Loading

Neighbor


gene id symbol gene type direction distance location
nucb2a LOC106562318 coding downstream 5136 33159342 ~ 33168228 (-)
LOC110506670 LOC106587508 coding downstream 247097 32900561 ~ 32926267 (-)
LOC110506665 polr2l coding downstream 342249 32829426 ~ 32831115 (-)
LOC110506664 sdhaf2 coding downstream 347615 32823041 ~ 32825749 (-)
LOC110506653 LOC106563521 coding downstream 587725 32528233 ~ 32585639 (-)
LOC118944422 NA coding upstream 213182 33386852 ~ 33388945 (-)
LOC100136595 calc1 coding upstream 627664 33800216 ~ 33815643 (-)
LOC110506676 pde3b coding upstream 672340 33846010 ~ 33927989 (-)
LOC110506684 LOC106587537 coding upstream 940839 34109965 ~ 34118269 (-)
LOC110506685 rbtn1 coding upstream 979006 34152676 ~ 34184095 (-)
G2022722 NA non-coding downstream 3619 33169454 ~ 33169745 (-)
G2022720 NA non-coding downstream 6009 33165551 ~ 33167355 (-)
G2022150 NA non-coding downstream 30571 33142557 ~ 33142793 (-)
G2022141 NA non-coding downstream 38519 33134589 ~ 33134845 (-)
G2022140 NA non-coding downstream 64720 33108440 ~ 33108644 (-)
G2022728 LOC107586033 non-coding upstream 6063 33179733 ~ 33183283 (-)
G2022813 NA non-coding upstream 144240 33317910 ~ 33319072 (-)
G2022939 NA non-coding upstream 355697 33529367 ~ 33532946 (-)
G2022946 NA non-coding upstream 366625 33540295 ~ 33541186 (-)
G2022919 NA non-coding upstream 377985 33551655 ~ 33556519 (-)
G2022042 LOC106562320 other downstream 294593 32875255 ~ 32878771 (-)
G2021975 NA other downstream 338883 32831627 ~ 32834481 (-)
G2021979 NA other downstream 354384 32810623 ~ 32818980 (-)
G2021956 NA other downstream 456451 32716126 ~ 32716913 (-)
LOC110506691 LOC106562361 other upstream 1327183 34499589 ~ 34523950 (-)
G2024673 NA other upstream 1702752 34876422 ~ 34928381 (-)
G2024949 NA other upstream 2222404 35396074 ~ 35399967 (-)
G2025061 NA other upstream 2322117 35495787 ~ 35497803 (-)

Expression


G2022726 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2022726 Expression in each Bioproject

Bar chart with 13 bars.
G2022726 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network