G2024673



Basic Information


Item Value
gene id G2024673
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 34876422 ~ 34928381 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2315702
cctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaacctgatggagtctgcaaaagacctgagacttggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgatgatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2315702 True 337 TUCP 0.43 2 34876422 34928381
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944477 NA coding downstream 90009 34778714 ~ 34786413 (-)
LOC110506695 LOC106562360 coding downstream 275880 34585124 ~ 34600542 (-)
LOC110506693 LOC106562359 coding downstream 293328 34530588 ~ 34583094 (-)
LOC110506692 fa60a coding downstream 346194 34524997 ~ 34530228 (-)
LOC110506691 LOC106562361 coding downstream 352472 34499589 ~ 34523950 (-)
pepd LOC106562343 coding upstream 110204 35038585 ~ 35049686 (-)
LOC110506721 LOC106562390 coding upstream 473120 35401501 ~ 35548790 (-)
LOC110506723 LOC106562376 coding upstream 634034 35562415 ~ 35607286 (-)
LOC110506725 LOC106562378 coding upstream 712493 35640874 ~ 35680665 (-)
sdr42e1 LOC106562336 coding upstream 752701 35681082 ~ 35684650 (-)
G2024671 NA non-coding downstream 10227 34865973 ~ 34866195 (-)
G2024670 NA non-coding downstream 12524 34863530 ~ 34863898 (-)
G2024669 LOC106594537 non-coding downstream 13377 34860359 ~ 34863045 (-)
G2024662 NA non-coding downstream 18144 34857808 ~ 34858278 (-)
G2024052 NA non-coding downstream 42737 34833376 ~ 34833685 (-)
G2024782 NA non-coding upstream 103631 35032012 ~ 35032292 (-)
G2024783 NA non-coding upstream 104675 35033056 ~ 35033404 (-)
G2024708 NA non-coding upstream 107275 35035656 ~ 35036567 (-)
G2024792 NA non-coding upstream 132305 35060686 ~ 35061132 (-)
G2024794 NA non-coding upstream 134714 35063095 ~ 35063329 (-)
LOC100136595 calc1 other downstream 1072098 33800216 ~ 33815643 (-)
G2022042 LOC106562320 other downstream 1997651 32875255 ~ 32878771 (-)
G2021975 NA other downstream 2041941 32831627 ~ 32834481 (-)
G2021979 NA other downstream 2057442 32810623 ~ 32818980 (-)
G2024949 NA other upstream 467693 35396074 ~ 35399967 (-)
G2025061 NA other upstream 567406 35495787 ~ 35497803 (-)
G2025757 NA other upstream 1414775 36343156 ~ 36343434 (-)
LOC110506740 LOC106562403 other upstream 1906352 36793286 ~ 36913660 (-)

Expression


G2024673 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2024673 Expression in each Bioproject

Bar chart with 20 bars.
G2024673 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network