G2025757



Basic Information


Item Value
gene id G2025757
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 36343156 ~ 36343434 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2316868
tggccatgcacgcctccaactcaatcatcaagtttgcggacgacactacagtgttaggcttgattaccaacaacgacgggacggcctacagggaggaggtgagggccctcggagtgtggtgtcaggaaaatagactcacactcaacgtcaacaaaacaaaggaggacttcaggaaacagcagagggagcacccacctatccacatcgacgggacagtagtggagagggtagtaagttttaagttccttggcgtacacatcacggacaaactgaattggt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2316868 True 279 TUCP 0.51 1 36343156 36343434
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506737 LOC106587587 coding downstream 183625 36144492 ~ 36159531 (-)
LOC110506734 LOC106562388 coding downstream 362206 35978091 ~ 35980950 (-)
LOC110506732 brd7 coding downstream 522264 35813003 ~ 35820892 (-)
sdr42e1 LOC106562336 coding downstream 658506 35681082 ~ 35684650 (-)
LOC110506725 LOC106562378 coding downstream 662491 35640874 ~ 35680665 (-)
LOC110506738 tox3 coding upstream 156456 36499890 ~ 36564258 (-)
LOC110511520 LOC106587590 coding upstream 427455 36770889 ~ 36783965 (-)
LOC110506740 LOC106562403 coding upstream 449852 36793286 ~ 36913660 (-)
LOC110506741 LOC106587594 coding upstream 571340 36914774 ~ 36923482 (-)
LOC110506744 LOC106562437 coding upstream 961416 37304850 ~ 37308246 (-)
G2025728 NA non-coding downstream 23006 36319944 ~ 36320150 (-)
G2025696 NA non-coding downstream 58896 36282765 ~ 36284260 (-)
G2025635 NA non-coding downstream 99372 36243512 ~ 36243784 (-)
G2025613 NA non-coding downstream 110386 36232557 ~ 36232770 (-)
G2025590 NA non-coding downstream 135210 36207732 ~ 36207946 (-)
G2025759 NA non-coding upstream 2508 36345942 ~ 36346221 (-)
G2025765 NA non-coding upstream 9107 36352541 ~ 36352773 (-)
G2025778 NA non-coding upstream 19886 36363320 ~ 36363526 (-)
G2025790 NA non-coding upstream 28160 36371594 ~ 36371832 (-)
G2025817 NA non-coding upstream 45936 36389370 ~ 36389572 (-)
LOC110506721 LOC106562390 other downstream 794399 35401501 ~ 35548790 (-)
G2025061 NA other downstream 845353 35495787 ~ 35497803 (-)
G2024949 NA other downstream 943189 35396074 ~ 35399967 (-)
G2024673 NA other downstream 1414775 34876422 ~ 34928381 (-)
LOC110506691 LOC106562361 other downstream 1840670 34499589 ~ 34523950 (-)
G2026993 NA other upstream 1076977 37420411 ~ 37421037 (-)
G2027052 NA other upstream 1147418 37490852 ~ 37491416 (-)
LOC110506753 LOC106587607 other upstream 1994419 38334242 ~ 38373760 (-)
LOC110506757 LOC106562446 other upstream 2137168 38411123 ~ 38504156 (-)

Expression


G2025757 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2025757 Expression in each Bioproject

Bar chart with 14 bars.
G2025757 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network