G2026216



Basic Information


Item Value
gene id G2026216
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 36664704 ~ 36665047 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2317336
acattttatagtgatacataggacagtaagcataaactgcacacatttccattgctgtggaaggaacatgcaacatatgtacattttatgtcactcttccttaccaaaacaaattcaactgtgtgttctgggatatggtgtataatggagttggaatcaagtgaaccctctcacaactttgtatacgtggatgaggctgccttcaacctgaccaaatgcagaaggcggggtcagaatatcatcggtcacagagctactgtggatttgccaggccaacggggaggaaatatcaccatgtgtgctgctatttcggagcatggtgtcctaacccatatcccccttat

Function


NR:

description
PREDICTED: uncharacterized protein LOC106586404

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2317336 True 344 lncRNA 0.44 1 36664704 36665047

Neighbor


gene id symbol gene type direction distance location
LOC110506738 tox3 coding downstream 100446 36499890 ~ 36564258 (-)
LOC110506737 LOC106587587 coding downstream 505173 36144492 ~ 36159531 (-)
LOC110506734 LOC106562388 coding downstream 683754 35978091 ~ 35980950 (-)
LOC110506732 brd7 coding downstream 843812 35813003 ~ 35820892 (-)
sdr42e1 LOC106562336 coding downstream 980054 35681082 ~ 35684650 (-)
LOC110511520 LOC106587590 coding upstream 105842 36770889 ~ 36783965 (-)
LOC110506740 LOC106562403 coding upstream 128239 36793286 ~ 36913660 (-)
LOC110506741 LOC106587594 coding upstream 249727 36914774 ~ 36923482 (-)
LOC110506744 LOC106562437 coding upstream 639803 37304850 ~ 37308246 (-)
LOC118944515 NA coding upstream 1134350 37798150 ~ 37800786 (-)
G2026212 NA non-coding downstream 2235 36661814 ~ 36662469 (-)
G2026206 LOC106581475 non-coding downstream 7388 36657046 ~ 36657316 (-)
G2026205 NA non-coding downstream 7663 36656710 ~ 36657041 (-)
G2026200 NA non-coding downstream 9758 36654736 ~ 36654946 (-)
G2026170 NA non-coding downstream 30714 36633789 ~ 36633990 (-)
G2026387 NA non-coding upstream 49109 36714156 ~ 36738719 (-)
G2026442 NA non-coding upstream 184161 36849208 ~ 36853067 (-)
G2026449 NA non-coding upstream 203473 36868520 ~ 36880808 (-)
G2026474 NA non-coding upstream 259597 36924644 ~ 36924944 (-)
G2026505 NA non-coding upstream 287664 36952711 ~ 36952985 (-)
G2025757 NA other downstream 321270 36343156 ~ 36343434 (-)
LOC110506721 LOC106562390 other downstream 1115947 35401501 ~ 35548790 (-)
G2025061 NA other downstream 1166901 35495787 ~ 35497803 (-)
G2024949 NA other downstream 1264737 35396074 ~ 35399967 (-)
G2024673 NA other downstream 1736323 34876422 ~ 34928381 (-)
G2026993 NA other upstream 755364 37420411 ~ 37421037 (-)
G2027052 NA other upstream 825805 37490852 ~ 37491416 (-)
LOC110506753 LOC106587607 other upstream 1672806 38334242 ~ 38373760 (-)
LOC110506757 LOC106562446 other upstream 1815555 38411123 ~ 38504156 (-)

Expression


G2026216 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2026216 Expression in each Bioproject

Bar chart with 18 bars.
G2026216 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network