G2030153



Basic Information


Item Value
gene id G2030153
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 40884731 ~ 40885082 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2322040
tcacaacatgttaaatagatccactgttatgtcaccattaaagggttgagagtaaagtagagcccagtcacaacatgttaaatagatccactgttatgtcaccattaaagggttgagagtaaagtagagcccggtcacaacatgttaaatagatccactgttatgtcaccattaaagggttgagagtaaagtagagcccagtcacaacatgttaaatagatccactgttatgtcaccattaaagggttgagagtaaagtagagcccagtcacaacatgttaaatagatccactgttatgtcaccattaaagggttgagagtaaagtagagcccggtcacaacatgttaaatg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2322040 True 352 lncRNA 0.39 1 40884731 40885082
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944423 NA coding downstream 12056 40871432 ~ 40873618 (-)
LOC110519157 slc24a5 coding downstream 52439 40804103 ~ 40832292 (-)
LOC110506139 slc12a1 coding downstream 148505 40680421 ~ 40736226 (-)
dut dut coding downstream 216889 40663518 ~ 40667842 (-)
LOC110519217 LOC106587666 coding downstream 518784 40335544 ~ 40365947 (-)
LOC110519559 LOC106562535 coding upstream 52948 40938030 ~ 40983650 (-)
LOC110506810 LOC106562534 coding upstream 546180 41431262 ~ 41439598 (-)
LOC110515873 LOC106562546 coding upstream 577634 41461857 ~ 41567947 (-)
LOC118944424 LOC106587313 coding upstream 775220 41660302 ~ 41665080 (-)
LOC118944452 LOC106587168 coding upstream 780115 41665197 ~ 41675473 (-)
G2030152 NA non-coding downstream 659 40883733 ~ 40884072 (-)
G2030151 NA non-coding downstream 2043 40882436 ~ 40882688 (-)
G2030150 NA non-coding downstream 2534 40881909 ~ 40882197 (-)
G2030147 NA non-coding downstream 12149 40872187 ~ 40872582 (-)
G2030154 NA non-coding upstream 1553 40886635 ~ 40886953 (-)
G2030161 NA non-coding upstream 12198 40897280 ~ 40898098 (-)
G2030163 NA non-coding upstream 14027 40899109 ~ 40899558 (-)
G2030164 NA non-coding upstream 25683 40910765 ~ 40911861 (-)
G2030166 NA non-coding upstream 27983 40913065 ~ 40913400 (-)
G2030106 NA other downstream 105743 40775714 ~ 40778988 (-)
G2029858 fbn1 other downstream 317219 40551179 ~ 40567512 (-)
G2029844 NA other downstream 376449 40507746 ~ 40508282 (-)
LOC110506132 LOC106562499 other downstream 614956 40213044 ~ 40269852 (-)
pldn pldn other downstream 683916 40197134 ~ 40200916 (-)
G2030157 NA other upstream 2521 40887603 ~ 40888684 (-)
G2030162 NA other upstream 13388 40898470 ~ 40899021 (-)
G2030156 NA other upstream 21541 40906623 ~ 40907193 (-)
G2030291 NA other upstream 326395 41211477 ~ 41211852 (-)

Expression


G2030153 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2030153 Expression in each Bioproject

Bar chart with 12 bars.
G2030153 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network