G2030784



Basic Information


Item Value
gene id G2030784
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 41823533 ~ 41824041 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2322787
CTCGCACAATCATTAACACATTAATCAAAAGCCTCTTAAAAGGTAGACAATTTATTTAACAAAAATATCAGCTGAGATCAGCTCCTATGTCATACAGGAAAATGTTTACAAAGAGAGAACAGTAAATGCATACAATACAGGAAGTTGAACTAACAATAAGGTCCGGGTTTAACTACAGGCTCATTCACACATAGTGAGGGATCACATTATAGGCTACAACAAAATGTAGGTGGGTCCATAATGTACTACAGTTGTGTAGGTATAGTAATCATACATTATATTACAATATAACACATCTATCAACAGTCATAGATATGCATACTGTAAAGATCTGGCTCATGACCACAGAACAACTGTGTAGATGTTTTAATACTATCTAGTGTACTTCAATGATAATCTGAGGACAACCACTGGAAATTAGCTCAGGTATGATGGTGCATCTGACTGTTGTTCATTCAATCTCTAGATCATATCTGTCCCTATCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2322787 True 485 lncRNA 0.35 2 41823533 41824041

Neighbor


gene id symbol gene type direction distance location
LOC110506143 LOC106562454 coding downstream 43665 41755021 ~ 41779868 (-)
LOC118944455 lysm2 coding downstream 85440 41723275 ~ 41738093 (-)
LOC118944452 LOC106587168 coding downstream 148060 41665197 ~ 41675473 (-)
LOC118944424 LOC106587313 coding downstream 158453 41660302 ~ 41665080 (-)
LOC110515873 LOC106562546 coding downstream 255586 41461857 ~ 41567947 (-)
LOC110506142 LOC106562525 coding upstream 3507 41827548 ~ 41862932 (-)
LOC110506831 NA coding upstream 67894 41891935 ~ 41895295 (-)
LOC118944570 NA coding upstream 69090 41893131 ~ 41893245 (-)
LOC118936287 NA coding upstream 82783 41906824 ~ 41916531 (-)
LOC118944569 NA coding upstream 86762 41910803 ~ 41911004 (-)
G2030785 LOC106587817 non-coding downstream 1910 41814750 ~ 41821623 (-)
G2030811 NA non-coding downstream 17828 41805475 ~ 41805705 (-)
G2030810 NA non-coding downstream 19190 41804103 ~ 41804343 (-)
G2030792 NA non-coding downstream 71797 41751035 ~ 41751736 (-)
G2030790 NA non-coding downstream 73479 41749851 ~ 41750054 (-)
G2030830 NA non-coding upstream 40055 41864096 ~ 41864334 (-)
G2030831 NA non-coding upstream 41978 41866019 ~ 41866320 (-)
G2030937 NA non-coding upstream 63657 41887698 ~ 41903072 (-)
G2030942 NA non-coding upstream 66140 41890181 ~ 41905076 (-)
G2030944 NA non-coding upstream 67839 41891880 ~ 41915752 (-)
G2030291 NA other downstream 611681 41211477 ~ 41211852 (-)
G2030156 NA other downstream 916340 40906623 ~ 40907193 (-)
G2030162 NA other downstream 924512 40898470 ~ 40899021 (-)
G2030157 NA other downstream 934849 40887603 ~ 40888684 (-)
LOC110506841 cart other upstream 323319 42147360 ~ 42148871 (-)
LOC118944568 LOC106562433 other upstream 392398 42214901 ~ 42217502 (-)
G2031225 NA other upstream 519241 42343282 ~ 42346725 (-)
G2031259 NA other upstream 544213 42368254 ~ 42369909 (-)
G2031286 LOC106562727 other upstream 635216 42459257 ~ 42461315 (-)

Expression


G2030784 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.5.
End of interactive chart.

G2030784 Expression in each Bioproject

Bar chart with 8 bars.
G2030784 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network