G2030831



Basic Information


Item Value
gene id G2030831
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 41866019 ~ 41866320 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2322835
ctctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacggtatgtttggcgtaaaagcaacacagctcatcaccctgaacacaccataccc

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2322835 True 302 lncRNA 0.43 1 41866019 41866320
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506142 LOC106562525 coding downstream 3087 41827548 ~ 41862932 (-)
LOC110506143 LOC106562454 coding downstream 86151 41755021 ~ 41779868 (-)
LOC118944455 lysm2 coding downstream 127926 41723275 ~ 41738093 (-)
LOC118944452 LOC106587168 coding downstream 190546 41665197 ~ 41675473 (-)
LOC118944424 LOC106587313 coding downstream 200939 41660302 ~ 41665080 (-)
LOC110506831 NA coding upstream 25615 41891935 ~ 41895295 (-)
LOC118944570 NA coding upstream 26811 41893131 ~ 41893245 (-)
LOC118936287 NA coding upstream 40504 41906824 ~ 41916531 (-)
LOC118944569 NA coding upstream 44483 41910803 ~ 41911004 (-)
LOC110506839 NA coding upstream 118318 41984638 ~ 41986095 (-)
G2030830 NA non-coding downstream 1685 41864096 ~ 41864334 (-)
G2030784 NA non-coding downstream 41978 41823533 ~ 41824041 (-)
G2030785 LOC106587817 non-coding downstream 44396 41814750 ~ 41821623 (-)
G2030811 NA non-coding downstream 60314 41805475 ~ 41805705 (-)
G2030810 NA non-coding downstream 61676 41804103 ~ 41804343 (-)
G2030937 NA non-coding upstream 21378 41887698 ~ 41903072 (-)
G2030942 NA non-coding upstream 23861 41890181 ~ 41905076 (-)
G2030944 NA non-coding upstream 25560 41891880 ~ 41915752 (-)
G2030945 NA non-coding upstream 36994 41903314 ~ 41921439 (-)
G2030982 NA non-coding upstream 107935 41974255 ~ 41977636 (-)
LOC110515873 LOC106562546 other downstream 298106 41461857 ~ 41567947 (-)
G2030291 NA other downstream 654167 41211477 ~ 41211852 (-)
G2030156 NA other downstream 958826 40906623 ~ 40907193 (-)
G2030162 NA other downstream 966998 40898470 ~ 40899021 (-)
G2030157 NA other downstream 977335 40887603 ~ 40888684 (-)
LOC110506841 cart other upstream 281040 42147360 ~ 42148871 (-)
LOC118944568 LOC106562433 other upstream 350119 42214901 ~ 42217502 (-)
G2031225 NA other upstream 476962 42343282 ~ 42346725 (-)
G2031259 NA other upstream 501934 42368254 ~ 42369909 (-)
G2031286 LOC106562727 other upstream 592937 42459257 ~ 42461315 (-)

Expression


G2030831 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2030831 Expression in each Bioproject

Bar chart with 11 bars.
G2030831 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network