G2031110



Basic Information


Item Value
gene id G2031110
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 42319310 ~ 42320401 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2323200
gtctctctctctctttctaccccagcatgtctctctctctctctctctctctctctaccccagcctttctctttgcctctctctctctaccccagcctgtctctttgcctctctctctttctaccccagcctgtctctttgtctctctctctctctctctctctaccccagcctgtctctttgtctctctctctctctaccccagcctgtctctttgtctctctctctctctaccccagcctgtctctttgtctctctctctctctctaccccagcctgtctctttgtctcgctctctctctctgccccagcctgtctctttgtctctctcgctctctctctctgccccagcctgtctctttgtctctctcgctctctctttctgccccagcctgtctctttgtctctctcgctctctctctctgccccagcctgtctctttgtctctctcgctctctctctctctgccccagcctgtctctttgtctctctcgctctctctctgccccagcctgtctctctcgctcgctctctctctctaccccagcctgtctctttgtctctctcgctctctgccccagcctgtctctttgtctcgctctctctctctgccccagcctgtctcttttgtctctcgctctctctctctgccccagcctgtctctttgtctctctcgctctctctctcttccccagcctgtctctttgtctctctcgctctctctctctgccccagcctgtctctttgtctctctcgctctctctctctgccccagcctgtctctctcgctctctctctgccccagcctgtctctttgtctctctcgctctctgccccagcctgtctctttgtctcgctgtctctttctaccccagcctgtctctttctaccccagcctgtctctttgtctcgctctctctttctaccccagcctgtctctttgtctcgctctctctttctaccccagcctgtctctttgtctcgctctctctttctgccccagcctgtctctttgtctctc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2323200 True 1022 TUCP 0.56 2 42319310 42320401

Neighbor


gene id symbol gene type direction distance location
LOC110514283 LOC106562619 coding upstream 29614 42222592 ~ 42289696 (+)
LOC118936602 LOC106587807 coding upstream 175858 42138142 ~ 42143452 (+)
trnap-ugg-69 NA coding upstream 192491 42126746 ~ 42126819 (+)
LOC100136262 LOC106562517 coding upstream 200879 42053349 ~ 42118431 (+)
LOC110513173 LOC106562522 coding upstream 342245 41926763 ~ 41977068 (+)
LOC110506161 LOC106562727 coding downstream 77305 42397706 ~ 42461764 (+)
trnaa-ugc-184 NA coding downstream 94742 42415143 ~ 42415219 (+)
hypk hypk coding downstream 190376 42510777 ~ 42512275 (+)
LOC110526664 LOC106562628 coding downstream 245230 42565631 ~ 42576178 (+)
LOC110526666 prc1 coding downstream 255976 42576377 ~ 42586798 (+)
G2030926 tubgcp4 non-coding upstream 184345 42133071 ~ 42134965 (+)
G2030919 NA non-coding upstream 195596 42122515 ~ 42123714 (+)
G2030915 NA non-coding upstream 223446 42094690 ~ 42095864 (+)
G2030896 NA non-coding upstream 277292 42040384 ~ 42042018 (+)
G2030882 NA non-coding upstream 329878 41986196 ~ 41989432 (+)
G2031121 NA non-coding downstream 67206 42387607 ~ 42387812 (+)
G2031131 NA non-coding downstream 79707 42400108 ~ 42400394 (+)
G2031135 NA non-coding downstream 88065 42408466 ~ 42408777 (+)
G2031138 NA non-coding downstream 95017 42415418 ~ 42416015 (+)
LOC110526920 scg3 other upstream 596929 41688562 ~ 41722381 (+)
LOC110512697 LOC106562529 other upstream 676326 41600933 ~ 41643474 (+)
G2029990 NA other upstream 1405832 40912935 ~ 40913478 (+)
G2029691 NA other upstream 1777046 40541556 ~ 40542264 (+)
LOC110506777 LOC106592882 other upstream 2503979 39809065 ~ 39815331 (+)
G2031381 LOC106562638 other downstream 331358 42651759 ~ 42654496 (+)
spg21 spg21 other downstream 357812 42674297 ~ 42681389 (+)
G2031390 NA other downstream 365237 42685638 ~ 42687128 (+)
G2032117 NA other downstream 1218589 43538990 ~ 43539362 (+)
LOC110506879 LOC106587845 other downstream 1456186 43774037 ~ 43777549 (+)

Expression


G2031110 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2031110 Expression in each Bioproject

Bar chart with 19 bars.
G2031110 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network