G2031131



Basic Information


Item Value
gene id G2031131
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 42400108 ~ 42400394 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2323223
atgaaaatcatcaaaggtaagggaatatttattatgttatttctgatttctgttgactccaacatggcttagcttgttgttaatccacctggcatgtcagatttcaaaaaagcttttcggtgaaagcataccaagcatttatgtaaggacatctctctcagcagacaaaacattacaaacagctagcagcaaagtagattggtcacgaaagtcagaaaagcaataaaatgaatggcttacctttgatgatcttcggatgtttgcactcacgagactcccagttacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2323223 True 287 lncRNA 0.38 1 42400108 42400394

Neighbor


gene id symbol gene type direction distance location
crtc3 crtc3 coding upstream 23599 42293555 ~ 42376509 (+)
LOC110514283 LOC106562619 coding upstream 110412 42222592 ~ 42289696 (+)
LOC118936602 LOC106587807 coding upstream 256656 42138142 ~ 42143452 (+)
trnap-ugg-69 NA coding upstream 273289 42126746 ~ 42126819 (+)
LOC100136262 LOC106562517 coding upstream 281677 42053349 ~ 42118431 (+)
trnaa-ugc-184 NA coding downstream 14749 42415143 ~ 42415219 (+)
hypk hypk coding downstream 110383 42510777 ~ 42512275 (+)
LOC110526664 LOC106562628 coding downstream 165237 42565631 ~ 42576178 (+)
LOC110526666 prc1 coding downstream 175983 42576377 ~ 42586798 (+)
LOC118936412 LOC106562630 coding downstream 191229 42591623 ~ 42605399 (+)
G2031121 NA non-coding upstream 12296 42387607 ~ 42387812 (+)
G2030926 tubgcp4 non-coding upstream 265143 42133071 ~ 42134965 (+)
G2030919 NA non-coding upstream 276394 42122515 ~ 42123714 (+)
G2030915 NA non-coding upstream 304244 42094690 ~ 42095864 (+)
G2030896 NA non-coding upstream 358090 42040384 ~ 42042018 (+)
G2031135 NA non-coding downstream 8072 42408466 ~ 42408777 (+)
G2031138 NA non-coding downstream 15024 42415418 ~ 42416015 (+)
G2031139 NA non-coding downstream 15700 42416094 ~ 42416840 (+)
G2031140 NA non-coding downstream 17611 42418005 ~ 42418574 (+)
G2031141 NA non-coding downstream 19347 42419741 ~ 42421131 (+)
G2031110 NA other upstream 79707 42319310 ~ 42320401 (+)
LOC110526920 scg3 other upstream 677727 41688562 ~ 41722381 (+)
LOC110512697 LOC106562529 other upstream 757124 41600933 ~ 41643474 (+)
G2029990 NA other upstream 1486630 40912935 ~ 40913478 (+)
G2029691 NA other upstream 1857844 40541556 ~ 40542264 (+)
G2031381 LOC106562638 other downstream 251365 42651759 ~ 42654496 (+)
spg21 spg21 other downstream 277819 42674297 ~ 42681389 (+)
G2031390 NA other downstream 285244 42685638 ~ 42687128 (+)
G2032117 NA other downstream 1138596 43538990 ~ 43539362 (+)
LOC110506879 LOC106587845 other downstream 1376193 43774037 ~ 43777549 (+)

Expression


G2031131 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2031131 Expression in each Bioproject

Bar chart with 17 bars.
G2031131 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network