G2031863



Basic Information


Item Value
gene id G2031863
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 43398971 ~ 43399231 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2324165
ctcaaatcctgcagtgccagacgtgtccccctgtttaagccagtacatgtccaggcccgtctgaagtttgctagagagcatttggatgatccagaagaagattgggagaatgtcatatggtcagatgaaaccaaaatataactttttggtaaaaactcaactcgttgtgtttggaggacaaagaatgctgagttgcatccaaagaacaccatacctactgtgaagcatgggggtggaaacatcatgctttggggctgtttt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2324165 True 261 lncRNA 0.44 1 43398971 43399231
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110506077 LOC106562716 coding upstream 219069 43170678 ~ 43179902 (+)
LOC110515300 LOC106583399 coding upstream 238064 43084632 ~ 43160907 (+)
LOC110526703 tm6sf1 coding upstream 468490 42921887 ~ 42930481 (+)
LOC110511523 pcsk6 coding upstream 512033 42801870 ~ 42886938 (+)
LOC118944566 LOC106587688 coding upstream 658420 42726882 ~ 42748573 (+)
LOC110515557 efl1 coding downstream 40029 43439260 ~ 43535306 (+)
LOC118944556 NA coding downstream 160149 43559380 ~ 43567527 (+)
LOC110506869 mex3b coding downstream 193657 43592888 ~ 43597540 (+)
LOC110506879 LOC106587845 coding downstream 374819 43774037 ~ 43777549 (+)
LOC110526986 tmc3 coding downstream 430418 43829649 ~ 43879738 (+)
G2031818 NA non-coding upstream 127271 43270986 ~ 43271700 (+)
G2031792 NA non-coding upstream 198406 43200224 ~ 43200565 (+)
G2031781 NA non-coding upstream 228753 43169847 ~ 43170218 (+)
G2031778 NA non-coding upstream 233287 43165479 ~ 43165684 (+)
LOC110506863 LOC106594052 non-coding downstream 16529 43209258 ~ 43425863 (+)
G2031899 NA non-coding downstream 80031 43479262 ~ 43480390 (+)
G2031915 NA non-coding downstream 119116 43518347 ~ 43519019 (+)
G2032135 NA non-coding downstream 155273 43554504 ~ 43554776 (+)
G2032153 NA non-coding downstream 176021 43575252 ~ 43575565 (+)
G2031390 NA other upstream 711843 42685638 ~ 42687128 (+)
spg21 spg21 other upstream 717586 42674297 ~ 42681389 (+)
G2031381 LOC106562638 other upstream 744475 42651759 ~ 42654496 (+)
G2031110 NA other upstream 1078570 42319310 ~ 42320401 (+)
LOC110526920 scg3 other upstream 1676590 41688562 ~ 41722381 (+)
G2032117 NA other downstream 139759 43538990 ~ 43539362 (+)
G2033013 NA other downstream 1231244 44630475 ~ 44630763 (+)
LOC110516695 LOC106562481 other downstream 1563839 44963034 ~ 44971924 (+)
G2033166 NA other downstream 1573661 44972892 ~ 44973711 (+)

Expression


G2031863 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G2031863 Expression in each Bioproject

Bar chart with 21 bars.
G2031863 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network