G2032117



Basic Information


Item Value
gene id G2032117
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 43538990 ~ 43539362 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2324456
gatgaaactgtctctcatgaggaccgccacaggaaagacttacctctgctgtggtatgatgaaactggctctcatgaggaccgccacaggaaagacttacctctgctgtggtatgatgaaactggctctcatgaggaccgccacaggaaaggaagacccagagttacctctgctgtggtatgatgaaactggctctcatgaggaccgccacaggaaagacttacctctgctgtggtatgatgaaactggctctcatgaggaccgccacaggaaaggaagacccagagttacctctgctgcagagga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2324456 True 306 TUCP 0.52 2 43538990 43539362
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110515557 efl1 coding upstream 3684 43439260 ~ 43535306 (+)
LOC110506863 LOC106594052 coding upstream 113127 43209258 ~ 43425863 (+)
LOC110506077 LOC106562716 coding upstream 359088 43170678 ~ 43179902 (+)
LOC110515300 LOC106583399 coding upstream 378083 43084632 ~ 43160907 (+)
LOC110526703 tm6sf1 coding upstream 608509 42921887 ~ 42930481 (+)
LOC118944556 NA coding downstream 20018 43559380 ~ 43567527 (+)
LOC110506869 mex3b coding downstream 53526 43592888 ~ 43597540 (+)
LOC110506879 LOC106587845 coding downstream 234688 43774037 ~ 43777549 (+)
LOC110526986 tmc3 coding downstream 290287 43829649 ~ 43879738 (+)
LOC110506886 star5 coding downstream 344561 43883923 ~ 43895635 (+)
G2031915 NA non-coding upstream 19971 43518347 ~ 43519019 (+)
G2031899 NA non-coding upstream 58600 43479262 ~ 43480390 (+)
G2031863 NA non-coding upstream 139759 43398971 ~ 43399231 (+)
G2031818 NA non-coding upstream 267290 43270986 ~ 43271700 (+)
G2032135 NA non-coding downstream 15142 43554504 ~ 43554776 (+)
G2032153 NA non-coding downstream 35890 43575252 ~ 43575565 (+)
G2032179 NA non-coding downstream 79251 43618613 ~ 43618817 (+)
G2032182 NA non-coding downstream 84555 43623917 ~ 43624935 (+)
G2032193 NA non-coding downstream 100187 43639549 ~ 43639785 (+)
G2031390 NA other upstream 851862 42685638 ~ 42687128 (+)
spg21 spg21 other upstream 857605 42674297 ~ 42681389 (+)
G2031381 LOC106562638 other upstream 884494 42651759 ~ 42654496 (+)
G2031110 NA other upstream 1218589 42319310 ~ 42320401 (+)
LOC110526920 scg3 other upstream 1816609 41688562 ~ 41722381 (+)
G2033013 NA other downstream 1091113 44630475 ~ 44630763 (+)
LOC110516695 LOC106562481 other downstream 1423708 44963034 ~ 44971924 (+)
G2033166 NA other downstream 1433530 44972892 ~ 44973711 (+)
LOC110506180 lrrk1 other downstream 1532745 45041116 ~ 45184806 (+)

Expression


G2032117 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2032117 Expression in each Bioproject

Bar chart with 19 bars.
G2032117 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network