G2032150



Basic Information


Item Value
gene id G2032150
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 43569160 ~ 43570054 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2324491
accaaaaacatagagacccggaaaacctgagtctacgccttcactatggtgaatcactaaaacaatacagaaatacactacggaaaaagaaggaacagcatgtcagaaatcagctcaatgcaattgaagaatccatagactctaaccacttctgggaaaattggaaaacactaaacaaacaacaacacaaagaattatctatccaaaatggagatgtatgggtaaaccacttctccaatctttttggctctataacaaagaataaagagcaaaaacatatacatgatcaaatacagatcttagaatcaactattaaagactaccagaacccactggattctccaattacattgaatgagttacaggacaaaataaaaaccctccaacccaaaaaggcctgtggtgttgatggtatcctcaatgaaatgatcaaatatacagacaacaaattccaattggctatactaaaactctttaacatcatacttagctctggcatcttccccaatatttggaaccaaggactgatcaccccaatccacaaaagtggagacaaatttgaccccaataactaccgtggaatatgtgtcaacagtaaccttgggaaaatcctctgcattatcattaacagcagactcgtacatttcctcaatgaaaacaatgtactgagcaaatgtcaaattggctttttaccaaattaccgtacaacagaccatgtattcaccctgcacaccctaattgacaaccaaacaaaccaaaacaaaggcaaagtcttctcatactttgttgatttcaaaaaagccttcgactcaatttggcatgagggtctgctatacaaactgatggaaagtggtgttgggggtaaaacatacgacattataaaatccatgtacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2324491 True 895 TUCP 0.37 1 43569160 43570054

Neighbor


gene id symbol gene type direction distance location
LOC110506867 LOC106587795 coding downstream 129964 43428658 ~ 43439196 (-)
LOC110506858 LOC106562715 coding downstream 370983 43180007 ~ 43198177 (-)
LOC118944425 LOC106562717 coding downstream 406148 43161768 ~ 43163012 (-)
LOC110526985 LOC106592271 coding downstream 581878 42964294 ~ 42987282 (-)
LOC110526700 LOC106587711 coding downstream 614456 42940157 ~ 42954704 (-)
LOC118944426 NA coding upstream 210876 43780930 ~ 43792853 (-)
LOC110526988 LOC106587743 coding upstream 325961 43896015 ~ 43949012 (-)
LOC110526712 mesd1 coding upstream 427671 43997725 ~ 44001493 (-)
LOC110526709 cemip coding upstream 446969 44017023 ~ 44183848 (-)
LOC110526990 NA coding upstream 565669 44135723 ~ 44137626 (-)
G2032136 NA non-coding downstream 14363 43554505 ~ 43554797 (-)
G2032049 NA non-coding downstream 154853 43413387 ~ 43414307 (-)
G2032045 NA non-coding downstream 159101 43409655 ~ 43410059 (-)
G2032044 NA non-coding downstream 161401 43407499 ~ 43407759 (-)
G2032041 LOC106591065 non-coding downstream 176617 43392310 ~ 43392543 (-)
G2032156 NA non-coding upstream 15129 43585183 ~ 43585418 (-)
G2032172 NA non-coding upstream 42608 43612662 ~ 43612984 (-)
G2032178 NA non-coding upstream 46927 43616981 ~ 43617200 (-)
G2032197 NA non-coding upstream 70557 43640611 ~ 43641045 (-)
G2032198 NA non-coding upstream 71120 43641174 ~ 43641624 (-)
G2031974 NA other downstream 383436 43184636 ~ 43185724 (-)
LOC110513924 rasl12 other downstream 947614 42616181 ~ 42958849 (-)
G2031343 NA other downstream 1010257 42557797 ~ 42558903 (-)
G2031286 LOC106562727 other downstream 1107845 42459257 ~ 42461315 (-)
G2032544 tmc3 other upstream 309139 43879193 ~ 43881732 (-)
LOC110506903 LOC106562480 other upstream 1283799 44705368 ~ 44923032 (-)
LOC110506178 cers3 other upstream 1369184 44932382 ~ 44956996 (-)
LOC110506182 tecta other upstream 1769043 45338567 ~ 45358724 (-)

Expression


G2032150 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G2032150 Expression in each Bioproject

Bar chart with 19 bars.
G2032150 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network