G2032338



Basic Information


Item Value
gene id G2032338
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 43807386 ~ 43807769 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2324703
agcaaccttatcttccacacaaaccatcccctggcatggcacagtgccatattagcacactacccctttgttaagagagggggggttaacgaggggtggaaactcagaatacttgataacgaggactctgagttaagtaatataaatatctataaatccggaacagtaatggtacagaataaccacaaacagtttcagctggactttcacctaatcaaagaattagcccagcaggagaagctctcccttgataaagatacccccacaccgagcgggtcagaccagacctcttcattatgtaaccccacagatgagcaacccccagcggagagtcaacctcccagcacagattaccactccctcattgaaatgaaggacaaattc

Function


NR:

description
PREDICTED: uncharacterized protein LOC109098287

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2324703 True 384 lncRNA 0.46 1 43807386 43807769
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944426 NA coding downstream 14533 43780930 ~ 43792853 (-)
LOC110506867 LOC106587795 coding downstream 368190 43428658 ~ 43439196 (-)
LOC110506858 LOC106562715 coding downstream 609209 43180007 ~ 43198177 (-)
LOC118944425 LOC106562717 coding downstream 644374 43161768 ~ 43163012 (-)
LOC110526985 LOC106592271 coding downstream 820104 42964294 ~ 42987282 (-)
LOC110526988 LOC106587743 coding upstream 88246 43896015 ~ 43949012 (-)
LOC110526712 mesd1 coding upstream 189956 43997725 ~ 44001493 (-)
LOC110526709 cemip coding upstream 209254 44017023 ~ 44183848 (-)
LOC110526990 NA coding upstream 327954 44135723 ~ 44137626 (-)
LOC110506889 LOC106562647 coding upstream 390701 44198470 ~ 44231491 (-)
G2032335 NA non-coding downstream 1756 43805101 ~ 43805630 (-)
G2032333 NA non-coding downstream 2450 43804719 ~ 43804936 (-)
G2032318 NA non-coding downstream 15347 43791528 ~ 43792039 (-)
G2032313 NA non-coding downstream 20205 43786374 ~ 43787181 (-)
G2032310 NA non-coding downstream 27035 43777913 ~ 43780351 (-)
G2032339 NA non-coding upstream 169 43807938 ~ 43808423 (-)
G2032369 NA non-coding upstream 34751 43842520 ~ 43842820 (-)
G2032380 NA non-coding upstream 47393 43855162 ~ 43856760 (-)
G2032539 NA non-coding upstream 59602 43867371 ~ 43871855 (-)
G2032542 NA non-coding upstream 67876 43875645 ~ 43875909 (-)
G2032150 NA other downstream 237332 43569160 ~ 43570054 (-)
G2031974 NA other downstream 621662 43184636 ~ 43185724 (-)
LOC110513924 rasl12 other downstream 1185840 42616181 ~ 42958849 (-)
G2031343 NA other downstream 1248483 42557797 ~ 42558903 (-)
G2032544 tmc3 other upstream 71424 43879193 ~ 43881732 (-)
LOC110506903 LOC106562480 other upstream 1046084 44705368 ~ 44923032 (-)
LOC110506178 cers3 other upstream 1131469 44932382 ~ 44956996 (-)
LOC110506182 tecta other upstream 1531328 45338567 ~ 45358724 (-)

Expression


G2032338 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2032338 Expression in each Bioproject

Bar chart with 18 bars.
G2032338 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network